Genetic diversity of population, Biology

Assignment Help:

Genetic Diversity of Population

The biological diversity of animals, plants, and microorganisms is of fundamental importance to human survival. The term "gene resources" may be defined as the genetic diversity that is very essential for meeting the society's needs in perpetuity. This diversity is expressed in the differences between species as well as in the variation among individuals that comprise a species. Gene resources include wild and domestic species having many species of no commercial value. Every year gene resources are utilised to provide crores of rupees worth of new and familiar products e.g., food, clothing, shelter, pharmaceuticals, energy and hundreds of industrial products. You will be aware that a wide range of species and their products are required for medical and other research. Agricultural, forestry and related industries are dependent, whenever needed on appropriate diversity as for example resistance to plant diseases. It is this diversity that sets the limits to which both wild and domestic species can successfully adapt to changes involving:

  1. Weather, insects and disease,
  2. Technology,
  3. Demand and,
  4. Human preferences.

Most of the biological diversity is still found in natural ecosystems whose survival is dependent, in large part, on the diversity within them.


Related Discussions:- Genetic diversity of population

Can you explain deoxynivalenol mycotoxicosis, Q. Can you explain Deoxynival...

Q. Can you explain Deoxynivalenol Mycotoxicosis? During 1987, an outbreak estimated to have affected over 50,000 people in the State of Jammu and Kashmir, was traced to the c

Can you describe about hematosis, Q. What is hematosis? In humans where doe...

Q. What is hematosis? In humans where does hematosis occur? Hematosis is the oxygenation of the blood, venous blood (oxygen-poor) after hematosis is transformed into arterial b

What is the mn blood system, What is the MN blood system? What is the patte...

What is the MN blood system? What is the pattern of genetic inheritance of the MN blood system? A MN blood system is a third (in addition to the ABO and the Rh) system of blood

Describe about development of sexual maturity in children, Briefly Describe...

Briefly Describe about Development of Sexual Maturity in Children? Sexual maturity develops along with growth spurt in adolescence. In girls, growth stops on attaining menarche

Discuss briefly the color reactions of proteins, Question 1 List variou...

Question 1 List various methods used for determination of blood glucose. Explain the principle of each test. Add a note on advantages and disadvantages of each method Qu

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Relationship of different systems in diabetes mellitus, Describe the relati...

Describe the relationship of different systems in diabetes mellitus Diabetes Mellitus has direct relationship with endocrine system, especially with endocrine part of the panc

Filariasis, F i l a r i a s i s Animal filariasis is an import...

F i l a r i a s i s Animal filariasis is an important helminthic infection caused by large number of parasites. In bovines, it is caused by setaria, stephanofilaria, p

Male gamete and the female gamete in a flowering plant, What is (a) the mal...

What is (a) the male gamete, and (b) the female gamete in a flowering plant?   (a) The male gamete in a flowering plant is the pollen grain (strictly, the gamete is the male

What do you mean by bleeding index, Q. What do you mean by Bleeding Index? ...

Q. What do you mean by Bleeding Index? This factor is applicable at this stage to evaluate the health of one stage implants in which the transmucosal component allows the forma

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd