Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Genetic Diversity of Population
The biological diversity of animals, plants, and microorganisms is of fundamental importance to human survival. The term "gene resources" may be defined as the genetic diversity that is very essential for meeting the society's needs in perpetuity. This diversity is expressed in the differences between species as well as in the variation among individuals that comprise a species. Gene resources include wild and domestic species having many species of no commercial value. Every year gene resources are utilised to provide crores of rupees worth of new and familiar products e.g., food, clothing, shelter, pharmaceuticals, energy and hundreds of industrial products. You will be aware that a wide range of species and their products are required for medical and other research. Agricultural, forestry and related industries are dependent, whenever needed on appropriate diversity as for example resistance to plant diseases. It is this diversity that sets the limits to which both wild and domestic species can successfully adapt to changes involving:
Most of the biological diversity is still found in natural ecosystems whose survival is dependent, in large part, on the diversity within them.
Q. Can you explain Deoxynivalenol Mycotoxicosis? During 1987, an outbreak estimated to have affected over 50,000 people in the State of Jammu and Kashmir, was traced to the c
Q. What is hematosis? In humans where does hematosis occur? Hematosis is the oxygenation of the blood, venous blood (oxygen-poor) after hematosis is transformed into arterial b
What is the MN blood system? What is the pattern of genetic inheritance of the MN blood system? A MN blood system is a third (in addition to the ABO and the Rh) system of blood
Briefly Describe about Development of Sexual Maturity in Children? Sexual maturity develops along with growth spurt in adolescence. In girls, growth stops on attaining menarche
Question 1 List various methods used for determination of blood glucose. Explain the principle of each test. Add a note on advantages and disadvantages of each method Qu
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Describe the relationship of different systems in diabetes mellitus Diabetes Mellitus has direct relationship with endocrine system, especially with endocrine part of the panc
F i l a r i a s i s Animal filariasis is an important helminthic infection caused by large number of parasites. In bovines, it is caused by setaria, stephanofilaria, p
What is (a) the male gamete, and (b) the female gamete in a flowering plant? (a) The male gamete in a flowering plant is the pollen grain (strictly, the gamete is the male
Q. What do you mean by Bleeding Index? This factor is applicable at this stage to evaluate the health of one stage implants in which the transmucosal component allows the forma
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd