Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Foods to be avoided are:
High fibre foods like whole grain cereals and their products (e.g. whole wheat flour, cracked wheat, whole pulses)
Raw vegetables and fruits
Fried fatty foods
Chemical irritants like spices, pickles, papad, ketchups etc.
How the artificial sweeteners are available as sugar substitute? Some of these are available as tablets, as sugar substitute and others appear as ingredients in many food produ
Question 1 Write a short note on the following Impactors Land fills Bio stimulation Green house effects Question 2 What is bioremediation? Give an account o
Q. Illustrate goal of modern dentistry? The goal of modern dentistry is to restore the patient to normal contour, comfort, function, esthetics, speech and health regardless of
Q. Prevention and Control from escherichia coli? Prevention and Control: Involves avoiding contaminated food and water that have high coliform counts, avoiding unpasteurized ju
What is Hazard Identification Hazard Identification : The identification of known or potential health effects associated with a certain agent.
The concentration of the tissue fluid, which bathes all cells in the body, is kept more or less constant. Why is this important? If the tissue fluid became more dilute, the ce
Q. What is Rounded ST Depression? A rounded ST-segment depression pattern in the CM5 lead, as well as in the other leads, is common and is often associated with ischaemia. This
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Select the two correct statements out of the four (a - d) given below about lac operon. 1. Glucose or galactose may bind with the repressor and inactivate it 2. In the absenc
How does the sodium-potassium pump present in the cell membrane work? What is the importance of this protein for the cell? The sodium-potassium pump is the transport protein th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd