food and diet, Biology

Assignment Help:
state one benefit of including vegetable fibre in the diet

Related Discussions:- food and diet

Explain about the adipose tissue - energy balance, Explain about the Adipos...

Explain about the Adipose tissue - energy balance? At this point, it will not be irrelevant to consider how exactly an increase in the fat depot takes place. For understanding

Making smoke prints of leaves, Making smoke prints of leaves Smoke print...

Making smoke prints of leaves Smoke prints of leaves may be simply made by following the four steps shown in the diagrams. Cover the side of a smooth, round bottle with a thin l

Explain acid butt - carbohydrate utilization pattern test, Acid butt - carb...

Acid butt - carbohydrate utilization pattern test ? Acid butt (yellow) and acid slant (yellow) with or without gas production – Glucose along with lactose and/or sucrose, is deg

Suprasternal views, These views are obtained by placing the transducer in t...

These views are obtained by placing the transducer in the suprasternal notch with the ridge pointing cephalad. The neck is extended during the suprasternal notch examination. Thi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Acute aortic regurgitation-types of regurgitation, Acute Aortic Regurgitati...

Acute Aortic Regurgitation :  The most dramatic presentation occurs in dissection of the aortic root. Endocarditis of the native or prosthetic aortic valve may also lead to a

Haccp is a food-related operation, HACCP  is a food-related operation to: ...

HACCP  is a food-related operation to: A) Identify and assess hazard at every stage of operation, right from start to finish B) Determine the critical control points C) E

Explain about post-operative pain, Post-operative pain  There is some d...

Post-operative pain  There is some discomfort for about 24-48 hours. Persistent pain for a longer duration, with swelling, may indicate possible infection around the implant an

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd