Female reproductive system, Biology

Assignment Help:

FEMALE REPRODUCTIVE SYSTEM -

In female mammals the female reproductive system characteristically comprises of the ovary, uterus, placenta, vagina and vulva.

2235_female reproductivesystem.png

 

2421_female reproductivesystem.png

1242_female reproductivesystem1.png


Related Discussions:- Female reproductive system

Respiration, difference between the respiration occurs in lower and higher ...

difference between the respiration occurs in lower and higher organisms

Explain enzyme inhibition, ENZYME INHIBITION Enzymes are often inhibite...

ENZYME INHIBITION Enzymes are often inhibited by  the presence of  suitable inhibitors. Much of current drug therapy  is based  on this. Basically, there  are  three major  cla

What do you mean by somites, Q. What do you mean by somites? Somites ar...

Q. What do you mean by somites? Somites are differentiated portions of mesodermal tissue longitudinally distributed along the embryo and the somites originate the muscle portio

What is pulse rate, Pulse Each time the left ventricle contracts and fo...

Pulse Each time the left ventricle contracts and forces blood into the aorta, it expands to adjust additional blood. And blood already present is pushed to other section and al

How to use a key, Q. How to Use a Key? The use of a key is analogous to...

Q. How to Use a Key? The use of a key is analogous to travelling a high way, that forks repeatedly, each fork having roadside directions. If a traveller follows the proper dire

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is pulmonary stenosis, Pulmonary Stenosis :  The obstruction may be v...

Pulmonary Stenosis :  The obstruction may be valvar, infundibular or supra valvar.

Explain about the food analysis and chemistry, Explain about the Food analy...

Explain about the Food analysis and chemistry? Investigation of the basic composition and physical, organic and biochemical properties of food constituents at the molecular lev

Define the terms transcriptomics and transcriptome, 1. One of the greates c...

1. One of the greates challenges following the human genome project is to understand how genes are regulated and what functions they perform. a. Define the terms 'Transcriptomic

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd