Explain the pathogens of forest insects, Biology

Assignment Help:

Explain the Pathogens of forest insects?

Caterpillars that defoliate forest trees have main economic impacts. Many such species go through periodic outbreaks. The forces which drive the outbreaks are still hotly debated; the large spatial and temporal scales on which the outbreaks take place have severely constrained our capability to do conclusive experiments. Though, careful small-scale experimentation combined with process-based statistical models have led to recent, fast increases in our understanding of the roles of viral and fungal pathogens in controlling caterpillar populations. Understanding how variability in space, in time, and between caterpillars scales up to affect large-scale population dynamics will assist us decide when and where to target control measures like introduction of lab-raised pathogens.


Related Discussions:- Explain the pathogens of forest insects

Class hirudinea - classification of coelom, Class Hirudinea - Classificatio...

Class Hirudinea - Classification of Coelom These are leeches. Number of body segments of these types of animals is fixed; usually there are 34 segments in a few groups there m

Biosphere, The biosphere is composed of all living organism. This sphere in...

The biosphere is composed of all living organism. This sphere includes all the microorganism, plants and animals of earth. In fact biosphere involves interaction of living beings w

Aschelminthes, in what part of the human body aschelminthes found?

in what part of the human body aschelminthes found?

Legal rights of psychiatric patients, LEGAL RIGHTS OF PSYCHIATRIC PATIENTS:...

LEGAL RIGHTS OF PSYCHIATRIC PATIENTS: When a patient is admitted in psychiatric hospital he may be deprived of  the freedom  to leave the hospital, and also to maintain certai

Locomotor organelles, Locomotor Organelles The protozoan locomotor org...

Locomotor Organelles The protozoan locomotor organelle may be Flagella, Cilia or Pseudopodia. These are of considerable value in classification of protozo

Zoology, How does classifying animals based on similarities and traits help...

How does classifying animals based on similarities and traits help future scientists

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define vitamin k-dependent carboxylation, Define Vitamin K-dependent carbox...

Define Vitamin K-dependent carboxylation? Vitamin K acts as a cofactor in the synthesis of g-carboxyglutamic acid (Gla) from glutamic acid residues required for the normal coa

Define factors affecting energy expenditure and requirement, Define Factors...

Define Factors Affecting Energy Expenditure and Requirement? As mentioned earlier, the energy needs vary widely among individuals in a group. Why? A number of factors cause the

Calculate the ph - microbial survival and growth, Calculate the pH - microb...

Calculate the pH - microbial survival and growth? Presence of microorganisms also depends on the pH of the medium. Most bacteria grow optimally near neutral pH (optimum 6.5 - 7

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd