Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Pathogens of forest insects?
Caterpillars that defoliate forest trees have main economic impacts. Many such species go through periodic outbreaks. The forces which drive the outbreaks are still hotly debated; the large spatial and temporal scales on which the outbreaks take place have severely constrained our capability to do conclusive experiments. Though, careful small-scale experimentation combined with process-based statistical models have led to recent, fast increases in our understanding of the roles of viral and fungal pathogens in controlling caterpillar populations. Understanding how variability in space, in time, and between caterpillars scales up to affect large-scale population dynamics will assist us decide when and where to target control measures like introduction of lab-raised pathogens.
Class Hirudinea - Classification of Coelom These are leeches. Number of body segments of these types of animals is fixed; usually there are 34 segments in a few groups there m
The biosphere is composed of all living organism. This sphere includes all the microorganism, plants and animals of earth. In fact biosphere involves interaction of living beings w
in what part of the human body aschelminthes found?
LEGAL RIGHTS OF PSYCHIATRIC PATIENTS: When a patient is admitted in psychiatric hospital he may be deprived of the freedom to leave the hospital, and also to maintain certai
Locomotor Organelles The protozoan locomotor organelle may be Flagella, Cilia or Pseudopodia. These are of considerable value in classification of protozo
How does classifying animals based on similarities and traits help future scientists
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Vitamin K-dependent carboxylation? Vitamin K acts as a cofactor in the synthesis of g-carboxyglutamic acid (Gla) from glutamic acid residues required for the normal coa
Define Factors Affecting Energy Expenditure and Requirement? As mentioned earlier, the energy needs vary widely among individuals in a group. Why? A number of factors cause the
Calculate the pH - microbial survival and growth? Presence of microorganisms also depends on the pH of the medium. Most bacteria grow optimally near neutral pH (optimum 6.5 - 7
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd