Explain the alterations occurring in egg, Biology

Assignment Help:

Alterations occurring in egg

The quality, flavour, composition and functional properties of eggs are adversely affected more rapidly and to a greater extent by the speed and conditions of handling, uncoated shells, storage times and temperatures.

The nutritive value of frozen and dried eggs is essentially the same as that of fresh eggs.  The drying or freezing processes do not cause any significant loss of nutrients.  Properly stored, dried and frozen eggs show no subsequent nutrient loss.  This observation can be substantiated by the following facts. 

 

 


Related Discussions:- Explain the alterations occurring in egg

Can you explain coronary angioplasty, Q. Can you explain Coronary Angioplas...

Q. Can you explain Coronary Angioplasty? The concept of coronary angioplasty - enlargement of the lumen of a stenotic vessel by a catheter technique was first proposed by Dotte

Silver point and silver point removal-endodontics principles, Silver point:...

Silver point: -    Uses of silver point: ease of handing and placement, ductility, radiopacity,and have  some antibacterial activity. -    Lack of acceptable 3D seal of the ca

Standard mrna and fibroblasts, You have discovered a novel alternatively sp...

You have discovered a novel alternatively spliced gene (gene X) and you wish to study its regulation in an in vitro splicing assay.  The alternatively spliced product retains intro

What are the endocrine functions of the placenta, What are the endocrine fu...

What are the endocrine functions of the placenta? The placenta has endocrine function since it secretes the hormones progesterone and estrogen that maintain the endometrium (in

Zoonoses disease-milkers’ nodules, Milkers’ nodules Milkers’ nodules are c...

Milkers’ nodules Milkers’ nodules are caused either by cowpox virus, an orthopoxvirus or pseudocowpox virus, a parapoxvirus. These are relatively benign lesions that occur most co

Selection of coal, Better coal should have following characteristics (1)...

Better coal should have following characteristics (1)   It should have high calorific value. (2)   It should have low moisture content. (3)   It should have low ash  conte

Define non-dietary treatment of burns, Define Non-Dietary Treatment of Burn...

Define Non-Dietary Treatment of Burns? While good nutritional care should be provided to the patient as soon as feasible it is equally imperative and at times critical to provi

Explain about the deranged lipid profile, Explain about the Deranged lipid ...

Explain about the Deranged lipid profile? Lipids, as you are already aware, are important dietary constituents that include fats, steroids, phospholipids and glycolipids. A num

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Cell, The scientist who described cells as “many little boxes” was

The scientist who described cells as “many little boxes” was

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd