Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Alterations occurring in egg
The quality, flavour, composition and functional properties of eggs are adversely affected more rapidly and to a greater extent by the speed and conditions of handling, uncoated shells, storage times and temperatures.
The nutritive value of frozen and dried eggs is essentially the same as that of fresh eggs. The drying or freezing processes do not cause any significant loss of nutrients. Properly stored, dried and frozen eggs show no subsequent nutrient loss. This observation can be substantiated by the following facts.
Q. Can you explain Coronary Angioplasty? The concept of coronary angioplasty - enlargement of the lumen of a stenotic vessel by a catheter technique was first proposed by Dotte
Silver point: - Uses of silver point: ease of handing and placement, ductility, radiopacity,and have some antibacterial activity. - Lack of acceptable 3D seal of the ca
You have discovered a novel alternatively spliced gene (gene X) and you wish to study its regulation in an in vitro splicing assay. The alternatively spliced product retains intro
What are the endocrine functions of the placenta? The placenta has endocrine function since it secretes the hormones progesterone and estrogen that maintain the endometrium (in
Milkers’ nodules Milkers’ nodules are caused either by cowpox virus, an orthopoxvirus or pseudocowpox virus, a parapoxvirus. These are relatively benign lesions that occur most co
Better coal should have following characteristics (1) It should have high calorific value. (2) It should have low moisture content. (3) It should have low ash conte
Define Non-Dietary Treatment of Burns? While good nutritional care should be provided to the patient as soon as feasible it is equally imperative and at times critical to provi
Explain about the Deranged lipid profile? Lipids, as you are already aware, are important dietary constituents that include fats, steroids, phospholipids and glycolipids. A num
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
The scientist who described cells as “many little boxes” was
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd