Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Advantage of Sponge Method?
Advantage:
The method is suitable when the surface to be swabbed is large or low incidence of microbes in the environment.
a solution of 5mMol/L CaCl2 is separated from a solution of 1 micromole/L CaCl2 by a membrane that is selectively permeable to Ca+2 but is impermeable to Cl-1 what are the magnitu
Q Under which environments do echinoderms live? Echinoderms are marine animals and they live in salt water.
i need assignment on this topic
Tetanus This is an infectious, non-febrile disease of animals and man, and is characterised by spasmodic tetany and hyperaesthesia. The causative agent is Clostridium tetani,
Ranikhet disease Ranikhet disease, also known in the west as Newcastle disease, is a contagious and highly fatal disease of fowls caused by a virus of the genus Rubulavirus in
A large number of important drugs are derived from plants. For example Tubocuranin, derived from plant-based curare, is used as a muscle relaxant during surgery. Curianol, a Guy
How is the brain involved in the immune system? A. Immune cells that constitute body's biological defense against infections and toxins, have many things in common with nerve c
Diagrams of organisms in phylum porifera
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
How does brain recognize difference between high and low c and soft and loud sounds?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd