Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Phylum Bryophyta
The Bryophytes include the mosses and their close relatives. They are widely diverse and grow in a variety of place.
1) Life cycle shows alternation of generation between haploid, gamete-producing, gametophyte and a more prominent phase, the sporophytes, the diploid spore producing phase.
2) The gametophyte is without vascular tissue but is differentiated into stem and leaves; rhizoids are filamentous and used as anchorage.
3) Sporophyte is attached to gametophyte and derives nourishment from it. The most important feature of sporophyte is spore capsule (sporangium) which is carried at the end of a slender stalk above the gametophyte.
Q. Direct use values of biodiversity? Direct use values are for those goods that are ensured directly e.g. food and timber. Maintaining a wide range of components of biological
Cobalt (Co) - Micronutrients The Co concentration in the dry matter of plants grown in soil normally lies around 0.02 to 0.5 ppm. In soils the content varies from 1 to 40 ppm.
What is heterospermy?also give its significance?
Air Microbes
Question 1) What is megalobastic anemia? Discuss briefly its lab diagnosis. How would you differentiate megaloblastic anemia from other anemias? Question 2) What is hem
If for some reason our goblet cells are non-functional, this will adversely affect: 1. Production of somatostatin 2. Secretion of sebum from the sebaceous glands 3. Matura
Prostaglandins Prostaglandins belong to a subclass of lipids known as the eicosanoids because of their structural similarities to the C-20 polyunsaturated fatty acids, t
Q. What are the modes of transmission, main signs and symptoms and treatments of hepatitis A? The Hepatitis A is an acute disease of low mortality caused by the hepatitis A vir
Dry Stigma - Category of Stigma The Cotton (Gossypium hirsutum) stigma is covered with long unicellular hairs. At the time of pollination, the stigmatic hairs show a distinct
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd