Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain in detail about the optic nerve
The optic nerve contains more than one million axons that initiate in the ganglion cell layer of the retina. This structure originatcs at the back of the eye just above and medial to the posteiior pole. It contiilues on from the retinal nerve fibre layer. The optic nerve consists of visual fibres and pupillonlotus Iibres (for pupills~ry reflex and oculm movements). Fibres frbm peripheral retina lie deeper in retina but occupy the most supelficial pm-t of optic nerve while those from central retina are superficial in retina but centrally placed in the optic nerve.
BIOLOGY IN DISPELLING MYTHS AND MISBELIEFS - Varieties of myths still exist in our society, and can be removed by the knowledge of Biology. Some of these are- 1. Snake
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. How mineral salts participate in osmotic regulation? Osmotic pressure depends not on the nature of such particles and on the number of particles dissolved in a solution. Min
The improper handling and transfer of the solid wastes results in various health and environmental hazards, such as: 1. Spoilage of landscape: Municipal wastes heap up o
Explain the Physiology of Lactation? Lactogenesis is the onset of copious milk secretion around parturition, triggered by a fall in plasma progesterone levels. Although some co
COPPER It is a trace element which is available in most of the fruits. Maximum in heart, brain, kidney & crustaceans. By its deficiency monkin's disease is caused. Cop
Which of the following structures in a vertebrate with a four-chambered heart would have blood with the highest oxygen concentration? And why?
how?
Why do roots of many swamp plants have a special morphology? Swamp and marsh plants usually present supporting roots that ramify from portions of the stem above the ground help
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd