Explain in detail about the optic nerve, Biology

Assignment Help:

Explain in detail about the optic nerve

The optic nerve contains more than one million axons that initiate in the ganglion cell layer of the retina. This structure originatcs at the back of the eye just above and medial to the posteiior pole. It contiilues on from the retinal nerve fibre layer. The optic nerve consists of visual fibres and pupillonlotus Iibres (for pupills~ry reflex and oculm movements). Fibres frbm peripheral retina lie deeper in retina but occupy the most supelficial pm-t of optic nerve while those from central retina are superficial in retina but centrally placed in the optic nerve.


Related Discussions:- Explain in detail about the optic nerve

Biology in dispelling myths and misbeliefs, BIOLOGY IN DISPELLING MYTHS AND...

BIOLOGY IN DISPELLING MYTHS AND MISBELIEFS - Varieties of myths still exist in our society, and can be removed by the knowledge of Biology. Some of these are- 1.       Snake

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How mineral salts participate in osmotic regulation, Q. How mineral salts p...

Q. How mineral salts participate in osmotic regulation? Osmotic pressure depends not on the nature of such particles and on the number of particles dissolved in a solution. Min

Effects of solid waste pollution, The improper handling and transfer of the...

The improper handling and transfer of the solid wastes results in various health and environmental hazards, such as: 1.      Spoilage of landscape: Municipal wastes heap up o

Explain the physiology of lactation, Explain the Physiology of Lactation? ...

Explain the Physiology of Lactation? Lactogenesis is the onset of copious milk secretion around parturition, triggered by a fall in plasma progesterone levels. Although some co

Copper - mineral elements, COPPER It is a trace element which is availa...

COPPER It is a trace element which is available in most of the fruits. Maximum in heart, brain, kidney & crustaceans. By its deficiency monkin's disease is caused. Cop

Define structures in a vertebrate with a four-chambered, Which of the follo...

Which of the following structures in a vertebrate with a four-chambered heart would have blood with the highest oxygen concentration? And why?

Why do roots of many swamp plants have a special morphology, Why do roots o...

Why do roots of many swamp plants have a special morphology? Swamp and marsh plants usually present supporting roots that ramify from portions of the stem above the ground help

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd