Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain in brief about the Cell Membrane
All cells, whether prokaryotic or eukaryotic, are bound by a limiting membrane called the cell membrane or the plasma membrane. The cell membrane gives shape and mechanical strength to the cell and protects it from the environment. The cell membrane is composed of lipids and proteins, and in many cases about 2-5% carbohydrates are also present. These carbohydrates are linked to the proteins or lipids. In plants, the cell membrane is covered by a rigid cell wall whose major component is cellulose. In fungi, the cell wall is made of chitin. Among the various models proposed for the plasma membrane, the most satisfactory model that is generally accepted is the fluid mosaic model of S.J. Singer and G.L. Nicolson (1972). This model satisfactorily accounts for several of the observed properties of the plasma membrane.
Inhalation Route for Injection Therapies that can be administered by inhalation are oxygen, humidification-cool mist and steam, administering local medication. The commonly u
Define the Objectives to learn about the food processing? After studying this unit, you will be able to: Discuss the concepts and aims of food processing Describe t
Which are plant tissues that form the plant roots? Roots have a central portion called medulla made of vascular tissue outer phloem and inner xylem. Medulla is delimited by per
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Interactions between minerals Copper deficiency has been identified as a serious problem for grazing ruminants. A deficiency may be due to low concentrations of Cu in forage a
Do octopus and squids have exoskeleton? Octopus and squids normally do not produce external shell (some squid species can have an internal shell). One cephalopod group, the nau
HACCP is a food-related operation to: A) Identify and assess hazard at every stage of operation, right from start to finish B) Determine the critical control points C) E
In genetic recombination by crossing over what is the difference between parental gametes and recombinant gametes? The Parental gametes are those gametes that maintain the orig
Explain about the Asepsis - Methods of Food Processing? Food is a living system and it has natural protection mechanisms in its raw agricultural state. Just removed once from t
When conducting a hair comparison, what factors would you consider?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd