Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
a) Explain the polygonum type of embryo sac. Why is it generally referred to as monosporic ?
b) Explain human leucocyte antigen complex? Describe its role in organ transplantation.
Determine the term - Epilepsy In epilepsy, a person suffers from recurrent seizures of various types that register on an electroencephalogram and are associated with disturbanc
Define Iron - The Micronutrient Iron, as you may be aware, is a trace element present in the body. The body contains approximately 3 - 3.5 g of iron of which about two thirds i
For convenience, living things are placed into different groups. Taxonomic breakdown of living things comprises the following categories: Family, Class, Genus, Phylum, Order, K
what is omn viva ex ova?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Why are producers the first trophic level to advantage from the activity of decomposers? Decomposers return nutrients in dead tissues and wastes to the soil or water; producers
When a piece of thread is tied tightly around an animal pancreatic duct the animal experiences difficult in digestion but does not suffer from diabetes mellitus.Explain why?
what are viruses
what is the importance of itamembranous ossification
How is snow - blindness caused in humans? a) Mention the site where syngamy happens in amphibians and reptiles correspondingly.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd