Explain homogenization, Biology

Assignment Help:

Explain Homogenization

Homogenized milk will not be affected, as the fat globules are already broken up.  Homogenization increases the viscosity of whole milk but slightly decreases that of skim milk. This process breaks up the fat globule into much smaller ones and thereby provides a larger surface area. A film of protein is adsorbed on the surface of the globules and this surface being much larger than in the non-homogenized milk, a much greater adsorption takes place, which causes a higher viscosity. Skim milk, some of the protein particles may be broken and therefore, the viscosity will be reduced.

 


Related Discussions:- Explain homogenization

What emergency department after an automobile accident, An 22 year old man ...

An 22 year old man is admitted to the emergency department after an automobile accident. He has not lost a large amount of blood, but he suffers from a severe crush injury to hi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine the use of water soluble vitamin A, Water soluble Vitamin A  ...

Water soluble Vitamin A  Water soluble vitamin A is a yellowish green, slightly turbid, fluorescent liquid of faint characteristic odour. The taste is at first faintly sweet an

Target organ damage, Central Nervous System   Hypertension is one of th...

Central Nervous System   Hypertension is one of the leading causes of cerebrovascular disease. It has been associated with accelerated age related cognitive decline. The most d

Contra indication in circulatory assist devices, Contra Indication :  It i...

Contra Indication :  It is absolutely contra indicated if their is more than trivial aortic regurgitation. Aortic aneurysm and severe aorto iliac disease are also contra indicatio

What are plant hormones, What are plant hormones? Plant hormones, also ...

What are plant hormones? Plant hormones, also known as phytohormones, are substances that control the embryonic development and the growth of the adult plant.

Opium and morphine, OPIUM - Opium is milky latex obtained by incisin...

OPIUM - Opium is milky latex obtained by incising the unripe capsule of white poppy ( Papave r somniferum family paprarecea) It has eaten or smoke. Generally it

Describe food applications of alginate, Food Applications of alginate O...

Food Applications of alginate One of the most unusual properties of the alginates has been the ability of soluble alginate salts to produce attractive, edible gels or jellies.

Segments of environment:, Segments of Environment: The environment ...

Segments of Environment: The environment is not a simple distribution of gases but is highly complex and structured. It comprises of four segments:   Lithosphere

Dietary management during atherosclerosis, Q. Dietary management during ath...

Q. Dietary management during atherosclerosis? Dietary management and the nutrient requirements during atherosclerosis remain the same as for the management of dyslipidemia. Hen

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd