Explain femoral approach, Biology

Assignment Help:

Q. Explain Femoral Approach?

This approach involves the insertion of a catheter over a guidewire i.e. inserted into a sheath in the right femoral artery. Systemic anticoagulation is used (heparin). A series of preformed catheters are employed for the procedure - commonly the Judkins left and right catheter and the pigtail catheter though a host of other catheters are available for individual anatomical variations. The common size of catheters used are: 5F, 6F, 7F and 8F. The 6F size is now commonly used all over the world for diagnostic adult procedures. 


Related Discussions:- Explain femoral approach

Animal classification, Explain metachrosis in frogs? How it is different fr...

Explain metachrosis in frogs? How it is different from change of skin colour of chemleon?

Implementation of nursing care - meningitis, Implementation of Nursing Care...

Implementation of Nursing Care Isolate the Child: When the child is admitted with suspected meningitis, the nurse has to take care that child's isolation is essential to p

Plant biodiversity, discuss why obelia is considered to be a special organi...

discuss why obelia is considered to be a special organism in zoology

Symptoms of enteropathogenic escherichia coli, Symptoms: The E. coli gastro...

Symptoms: The E. coli gastroenteritis syndrome is caused by the ingestion of 10 6 -10 10 viable cells/g that must colonize the small intestine and produce  enterotoxin. The syndr

Aerobic cellular respiration during muscle exercise, Q. What happens when t...

Q. What happens when the oxygen supply is inadequate to maintain aerobic cellular respiration during muscle exercise? If oxygen from myoglobin or hemoglobin is not enough for t

What is recombination frequency, What is recombination frequency? Recom...

What is recombination frequency? Recombination frequency, or crossing over rate, is the percentage of recombinant gametes made by crossing over (in relation to the number of pa

Define the clotting factors, Q. What are clotting factors? Clotting fac...

Q. What are clotting factors? Clotting factors are substances (coenzymes, enzymes, reagents) necessary for the clotting stages to happen. Besides those triggering reagents and

Ovipary, Ovipary, Vivipary and Ovovivipary In each case of external a...

Ovipary, Vivipary and Ovovivipary In each case of external and in some cases of internal fertilisation, development of the fertilized egg (zygote) occurs outside the mother's

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd