Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Vitamin D (Calciferol - vitamin D2)
The main forms are Vitamin D2 (ergocalciferol-plant origin) and vitamin D3 (cholecalciferol-animal origin). Vitamin D2 forms colourless, acicular crystals or a crystalline powder without taste and of only faint odour. Vitamin D2 is easily soluble in either chloroform or benzene, ethanol, acetone and fatty oils and insoluble in water. Vitamin D2 is sensitive against atmospheric oxygen. It is not stable either in the presence of oxidizing substances and oxygen carriers. Moreover, vitamin D2 is destroyed by acids, metal ions as well as UV and visible light.
Explain the Radiographic Failure of Root Canal Treatment It is the persistence or development of pathosis radiographically. Specifically, this is a radiolucent lesion that has
why is obelia considered to of special interest in Zoology as an animal showing an intermediate grade of organisation?
Q. Can the amount of available energy in a given trophic level be larger than the available energy in inferior trophic levels? What does that condition means to the conformation of
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain the Techniques of Surgical Correction ? Techniques of Surgical Correction proximal Dissection (De Bakey type I and IZ or Stanford A) Monitoring lines are insert
Rare Species - Wildlife These are those species whose numbers are few or they live in such small areas or in such unusual environments (endemics), that they could quickly disa
What is Defective Colour Vision Defective colour vision is often called colour blindness. The ability to appreciate one or more of the primary colours is lacking. This can be e
Demographic Transition As we saw earlier, death rates and birth rates have been nearly equal throughout much of human history. However, in Western Europe, death rates began to
Explain Ventricular Septal Defect in details ? Indications of surgery : Some VSDs close spontaneously or become smaller in size. This has to be taken into consideratio
Explain Diabetic diets Diabetic diets : There are therapeutic modification in the quantity1 quality of various macronutrients particularly carbohydrates.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd