Explain about vitamin D, Biology

Assignment Help:

Vitamin D (Calciferol - vitamin D2)

The main forms are Vitamin D2 (ergocalciferol-plant origin) and vitamin D3 (cholecalciferol-animal origin). Vitamin D2 forms colourless, acicular crystals or a crystalline powder without taste and of only faint odour. Vitamin D2 is easily soluble in either chloroform or benzene, ethanol, acetone and fatty oils and insoluble in water. Vitamin D2 is sensitive against atmospheric oxygen. It is not stable either in the presence of oxidizing substances and oxygen carriers. Moreover, vitamin D2 is destroyed by acids, metal ions as well as UV and visible light.

 


Related Discussions:- Explain about vitamin D

Explain the radiographic failure of root canal treatment, Explain the Radio...

Explain the Radiographic Failure of Root Canal Treatment It is the persistence or development of pathosis radiographically. Specifically, this is a radiolucent lesion that has

Obelia, why is obelia considered to of special interest in Zoology as an an...

why is obelia considered to of special interest in Zoology as an animal showing an intermediate grade of organisation?

Show the energy pyramids, Q. Can the amount of available energy in a given ...

Q. Can the amount of available energy in a given trophic level be larger than the available energy in inferior trophic levels? What does that condition means to the conformation of

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the techniques of surgical correction , Explain  the Techniques of...

Explain  the Techniques of Surgical Correction ? Techniques of Surgical Correction proximal Dissection (De Bakey type I and IZ or Stanford A) Monitoring lines are insert

Rare species - wildlife, Rare Species - Wildlife These are those speci...

Rare Species - Wildlife These are those species whose numbers are few or they live in such small areas or in such unusual environments (endemics), that they could quickly disa

What is defective colour vision, What is Defective Colour Vision Defect...

What is Defective Colour Vision Defective colour vision is often called colour blindness. The ability to appreciate one or more of the primary colours is lacking. This can be e

Demographic transition, Demographic Transition As we saw earlier, deat...

Demographic Transition As we saw earlier, death rates and birth rates have been nearly equal throughout much of human history. However, in Western Europe, death rates began to

Explain ventricular septal defect in details, Explain Ventricular Septal De...

Explain Ventricular Septal Defect in details ? Indications of surgery :  Some VSDs close spontaneously or become smaller in size. This has to be taken into consideratio

Explain diabetic diets, Explain Diabetic  diets Diabetic  diets :  Th...

Explain Diabetic  diets Diabetic  diets :  There  are  therapeutic modification  in  the  quantity1 quality of  various macronutrients  particularly carbohydrates.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd