Explain about the pulmonary and respiratory system, Biology

Assignment Help:

Explain about the Pulmonary and Respiratory System?

With aging the chest wall becomes stiffer and less compliant and the muscular force of the diaphragm is reduced causing less compliance and less recoil of lungs. Thus, there is decrease in the maximum amount of air movement in and out of the lungs. With the decreasing function, the hygiene of respiratory airways -ability to clear microbial pathogens in compromised.

 


Related Discussions:- Explain about the pulmonary and respiratory system

Explain about the ascomycota - fungi, Explain about the Ascomycota - Fungi?...

Explain about the Ascomycota - Fungi? Ascomycota - Ascomycetes or sac-like fungi have septate mycelium. These are called so because sexual reproduction involves the formation o

Define the etiology for bulimia nervosa, Define the Etiology for Bulimia Ne...

Define the Etiology for Bulimia Nervosa? Bulimia nervosa is a multifaceted disorder with psycologic, physiologic, developmental and cultural components. There may be a genetic

What are the major organic molecules for living beings, Q. What are the maj...

Q. What are the major significant organic molecules for living beings? There are many types of organic molecules that are important for the living beings. Particularly importan

Parasitic diseases - fascioliasis, P a r a s i t i c Diseases ...

P a r a s i t i c Diseases F a s cioliasis It is a liverfluke infestation characterized by hepatic insufficiency, bile duct obstruction, and poor production per

Explain the sensory respiratory center - feature of medulla, Explain the Se...

Explain the Sensory Respiratory center - Feature of Medulla Respiratory center: The center for regulating rate and depth of respiration is present in the medulla. Here, nerve i

Define importance of nutrition in human body, Define Importance of Nutritio...

Define Importance of Nutrition in Human Body? Nutrition is increasingly being recognized as an important determinant, which modulates the biological process of ageing. Poor nut

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Translation in eukaryotes, Transcription in eukaryotes, a much more complex...

Transcription in eukaryotes, a much more complex procedure than in prokaryotes. In the eukaryotes, translation and transcription take place in several cellular compartments that ar

Define reagents required and methodology for fehling's test, Define Reagent...

Define Reagents required and Methodology for Fehling's Test? - Sugar solutions of glucose, fructose, galactose, lactose, maltose, sucrose, starch - Fehling A (Copper sulphat

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd