Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain about Mental foramen and nerve
Mental foramen is a strategically important landmark during osteotomy procedures. Its location and the possibility that an anterior loop of mental nerve may be present on the mesial of the mental foramen, needs consideration before placing implant medial to foramen to avoid mental nerve injury
Describe about the mitochondrial membranes The composition of the two mitochondrial membranes is entirely different. The outer membrane is rich in lipids and contains nearly 50
Class angiospermae (Flowering plants) Flowers are the reproductive structures. Ovules are protected within ovary, xylem vessels are present. After fertilisation the ovary develop
Give a detailed description of stereoblastula, please ?#
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
In 1954, Public Health Service organized an experiment in that nearly 2 million children in grades 1, 2 and 3 participated. Experiment was to test a vaccine. Name the disease c
Q. Do the amine and the carboxyl groups attached to central carbons participate in the union between amino acids? Yes. The nitrogen of the amine group of one amino acid binds t
To verify the effect of intra-specific competition on the growth of saplings of Eucalyptus dives, an experiment was designed in which two sets of pots were used. In the first set o
Explain the drawback of protein hydrolysates The drawback of many protein hydrolysates, is that when hydrolysed, most of the food proteins liberate bitter tasting peptides, wh
Genes and Alleles The inheritance of any character can be studied only when thcre are two contrasting conditions, such as yellow versus green seed colour (as observed by Mendel
Define Transport Proteins in Plasma? Transport proteins, embedded in lipid membranes, make easy the import of nutrients into cells or the release of toxic products into the sur
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd