Explain about mental foramen and nerve, Biology

Assignment Help:

Explain about Mental foramen and nerve

Mental foramen is a strategically important landmark during osteotomy procedures. Its location and the possibility that an anterior loop of mental nerve may be present on the mesial of the mental foramen, needs  consideration before placing implant medial to foramen to avoid mental nerve injury

 


Related Discussions:- Explain about mental foramen and nerve

Describe about the mitochondrial membranes, Describe about the mitochondria...

Describe about the mitochondrial membranes The composition of the two mitochondrial membranes is entirely different. The outer membrane is rich in lipids and contains nearly 50

Explain class angiospermae, Class angiospermae (Flowering plants) Flowers...

Class angiospermae (Flowering plants) Flowers are the reproductive structures. Ovules are protected within ovary, xylem vessels are present. After fertilisation the ovary develop

#Types of Blastula, Give a detailed description of stereoblastula, please ?...

Give a detailed description of stereoblastula, please ?#

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe polio, In 1954, Public Health Service organized an experiment in t...

In 1954, Public Health Service organized an experiment in that nearly 2 million children in grades 1, 2 and 3 participated. Experiment was to test a vaccine. Name the disease c

Amine and the carboxyl groups, Q. Do the amine and the carboxyl groups atta...

Q. Do the amine and the carboxyl groups attached to central carbons participate in the union between amino acids? Yes. The nitrogen of the amine group of one amino acid binds t

What is eucalyptus dive, To verify the effect of intra-specific competition...

To verify the effect of intra-specific competition on the growth of saplings of Eucalyptus dives, an experiment was designed in which two sets of pots were used. In the first set o

Explain the drawback of protein hydrolysates, Explain the drawback of prote...

Explain the drawback of protein hydrolysates The drawback of many protein hydrolysates, is that when hydrolysed, most of the food proteins liberate bitter  tasting peptides, wh

Genes and alleles, Genes and Alleles The inheritance of any character c...

Genes and Alleles The inheritance of any character can be studied only when thcre are two contrasting conditions, such as yellow versus green seed colour (as observed by Mendel

Define transport proteins in plasma, Define Transport Proteins in Plasma? ...

Define Transport Proteins in Plasma? Transport proteins, embedded in lipid membranes, make easy the import of nutrients into cells or the release of toxic products into the sur

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd