Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Erythema:
Erythema is one of the,commonest primary lesions of the skin. It is produced by the dilation of the cutaneous blood vessels. If the dilation is accompanied by increased permeability, redness and oederna of the skin is produced and features of urticaria1 eruption are seen. At times the cutaneous blood vessels are so irritated and damaged, that they permit the whole blood to pass through, as in purpuras (haemorrhagic rashes). Thus, it will be seen that these three lesions, erythema, urticaria and purpura, depend upon the degree of stimulation or damiige to the cutaneous vascular system.
Diaper Rash (Napkin Rash):
In infants it affects the areas of skin covered by the napkin. Lesions consist mainly of simple erythema, though they may become vesicular or even ulcerative. They are situated, most frequently, on the prominences, and may occupy the inner parts of the thighs, ,perineum and genitalia. Usually the flexures are not affected. The causes of napkin rash are wet or soiled napkins, soap left in the napkins after washing, strong ammonical urine and poor general health.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Zygotic or Suspensor Polyembryony Cleavage of the apical cells of the globular or filamentous proembryo produced by the zygote may result in two or more embryos in a seed. Th
What are pentoses? What are the roles of pentoses in DNA and RNA molecules? Pentoses are carbohydrates made of five carbons. The DNA molecule is made of a sequence of molecu
Q. Why are lysosomes known as "the cleaners" of the cell waste? Lysosomes carry out heterophagic and autophagic digestion autophagic digestion by digesting residual substances
Define Surface Sampling Food contact surfaces (e.g. storage tank, packaging material, ripening room, utensils, equipments, refrigerators etc.) which directly or indirectly (wal
Determine the function of human body system Human body has different systems to perform different functions. A system consists of organs to perform a particular set of function
Formation of Notochord and Somites The formation of notochord and somites from the transplanted dorsal lip was supposed; these are normally derived from cells of the dorsal li
Merits of Micro Propagation The special merits of micro propagation are: 1. It considerably increases the rate of multiplication 2. High rate of multiplication can be ma
What are allosteric enzymes? Allosteric regulators can be allosteric inhibitors or allosteric activators. The interaction among an allosteric enzyme and the allosteric inhibito
What is the mRNA sequence to this DNA sequence : Guanine, cytosine, adenine, adenine, thymine, guanine
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd