Erythema - common disorders of skin, Biology

Assignment Help:

Erythema:

Erythema is one of  the,commonest primary lesions of  the skin. It  is produced by  the dilation of the cutaneous blood vessels.  If the dilation  is accompanied  by increased permeability, redness and oederna of  the skin  is produced and features of urticaria1 eruption are seen. At  times the cutaneous blood vessels are so  irritated and  damaged, that they permit the whole blood  to pass through, as  in  purpuras (haemorrhagic  rashes).  Thus,  it will  be  seen that  these three lesions, erythema, urticaria and  purpura, depend  upon  the degree of stimulation or  damiige to the cutaneous vascular system. 

Diaper Rash (Napkin Rash):

In  infants it affects  the areas of skin covered  by  the napkin. Lesions  consist mainly of simple erythema, though they may become vesicular or even ulcerative. They are situated, most frequently, on  the prominences, and may occupy the inner parts of the thighs, ,perineum and genitalia.  Usually the flexures are not  affected.  The causes of  napkin rash are wet or  soiled napkins, soap  left  in  the napkins after washing, strong ammonical urine and poor general  health.  


Related Discussions:- Erythema - common disorders of skin

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Zygotic or suspensor polyembryony, Zygotic or Suspensor Polyembryony ...

Zygotic or Suspensor Polyembryony Cleavage of the apical cells of the globular or filamentous proembryo produced by the zygote may result in two or more embryos in a seed. Th

What are pentoses, What are pentoses? What are the roles of pentoses in DNA...

What are pentoses? What are the roles of pentoses in DNA and RNA molecules? Pentoses are carbohydrates made of five carbons. The DNA molecule is made of a sequence of molecu

Why are lysosomes known as the cleaners of the cell waste, Q. Why are lysos...

Q. Why are lysosomes known as "the cleaners" of the cell waste? Lysosomes carry out heterophagic and autophagic digestion autophagic digestion by digesting residual substances

Define surface sampling, Define Surface Sampling Food contact surfaces ...

Define Surface Sampling Food contact surfaces (e.g. storage tank, packaging material, ripening room, utensils, equipments, refrigerators etc.) which directly or indirectly (wal

Determine the functions of human body system, Determine the function of hum...

Determine the function of human body system Human body has different systems to perform different functions. A system consists of organs to perform a particular set of function

Formation of notochord and somites, Formation of Notochord and Somites ...

Formation of Notochord and Somites The formation of notochord and somites from the transplanted dorsal lip was supposed; these are normally derived from cells of the dorsal li

Merits of micro propagation, Merits of Micro Propagation The special m...

Merits of Micro Propagation The special merits of micro propagation are: 1. It considerably increases the rate of multiplication 2. High rate of multiplication can be ma

What are allosteric enzymes, What are allosteric enzymes? Allosteric re...

What are allosteric enzymes? Allosteric regulators can be allosteric inhibitors or allosteric activators. The interaction among an allosteric enzyme and the allosteric inhibito

Cell Help?, What is the mRNA sequence to this DNA sequence : Guanine, cyto...

What is the mRNA sequence to this DNA sequence : Guanine, cytosine, adenine, adenine, thymine, guanine

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd