Energy metabolism, Biology

Assignment Help:

Energy Metabolism

In the preceding sections of the unit, you studied how the products of digestion of food, viz: amino acids, sugars and fatty acids are absorbed and transported to the body tissues. The oxidation of these compounds yields virtually all the chemical energy required animals and the use of this chemical energy is referred to as their energy metabolism.

Generally carbohydrates and fats are the fuel which provides energy but other organic compounds are within wide limits interchangeable in energy metabolism. How do we measure the rate of metabolism or the actual amount of energy liberated during oxidative metabolism? One way could be to measure the total heat produced by the organism per unit of time. This is the metabolic rate of the organism. The metabolic rate can be determined by using the formulation:

 Rate of energy intake - rate of energy loss per unit time = metabolic rate


Related Discussions:- Energy metabolism

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Why do roots of many swamp plants have a special morphology, Why do roots o...

Why do roots of many swamp plants have a special morphology? Swamp and marsh plants usually present supporting roots that ramify from portions of the stem above the ground help

Define the principles of periapical surgery (pas), Define the Principles of...

Define the Principles of Periapical Surgery (PAS)   1. Avoid horizontal, sever angled vertical incision Because the collagen fibers of the mucoperiosteum are parallel to the to

Indications for surgery, Indications 1) Symptomatic patient with normal...

Indications 1) Symptomatic patient with normal LV function (ejection fraction 2 0.5 at rest). If they are in class In or IV NYHA, surgery is recommended. In this group of pat

Nutritional factor that contribute to the malnutrition - chd, Define Nutrit...

Define Nutritional and metabolic factors that contribute to the malnutrition of CHD? Nutritional and metabolic factors that contribute to the malnutrition of CHD infant are ele

Ecology, three types of trophic pyramids

three types of trophic pyramids

What are the antigen-presenting cells of the immune system, What are the an...

What are the antigen-presenting cells of the immune system? The antigen-presenting cells of the immune system, also called as APC cells, are cells that do phagocytosis and dige

Coccidioidomycosis, Coccidioidomycosis Coccidioidomycosis is a soil-...

Coccidioidomycosis Coccidioidomycosis is a soil-borne infection of pet, domestic, wild animals and  man. The disease is caused by Coccidioides immitis, a dimorphic fungus wh

Tapeworm, life cycle of tapeworm in detail

life cycle of tapeworm in detail

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd