Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Energy Metabolism
In the preceding sections of the unit, you studied how the products of digestion of food, viz: amino acids, sugars and fatty acids are absorbed and transported to the body tissues. The oxidation of these compounds yields virtually all the chemical energy required animals and the use of this chemical energy is referred to as their energy metabolism.
Generally carbohydrates and fats are the fuel which provides energy but other organic compounds are within wide limits interchangeable in energy metabolism. How do we measure the rate of metabolism or the actual amount of energy liberated during oxidative metabolism? One way could be to measure the total heat produced by the organism per unit of time. This is the metabolic rate of the organism. The metabolic rate can be determined by using the formulation:
Rate of energy intake - rate of energy loss per unit time = metabolic rate
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Why do roots of many swamp plants have a special morphology? Swamp and marsh plants usually present supporting roots that ramify from portions of the stem above the ground help
Define the Principles of Periapical Surgery (PAS) 1. Avoid horizontal, sever angled vertical incision Because the collagen fibers of the mucoperiosteum are parallel to the to
Indications 1) Symptomatic patient with normal LV function (ejection fraction 2 0.5 at rest). If they are in class In or IV NYHA, surgery is recommended. In this group of pat
Define Nutritional and metabolic factors that contribute to the malnutrition of CHD? Nutritional and metabolic factors that contribute to the malnutrition of CHD infant are ele
three types of trophic pyramids
Definition and applications
What are the antigen-presenting cells of the immune system? The antigen-presenting cells of the immune system, also called as APC cells, are cells that do phagocytosis and dige
Coccidioidomycosis Coccidioidomycosis is a soil-borne infection of pet, domestic, wild animals and man. The disease is caused by Coccidioides immitis, a dimorphic fungus wh
life cycle of tapeworm in detail
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd