Energy during myocardial infarction, Biology

Assignment Help:

Q. Energy during myocardial infarction?

As mentioned above, patient who have recently suffered from an attack of myocardial infarction are hospitalized in the intensive cardiac care unit wherein their movement is strictly restricted and they generally are advised not to socialize a lot. Thus, the energy expenditure on physical activity is very low or negligible. The diet should therefore provide enough calories to meet the basal requirements, hence a low-calorie diet is recommended. Other benefits of providing a low calorie diet include: reduction in the adipose tissue mass particularly among obese patients and hence reduced oxygen requirements of the body (tissues); reduction in the requirement of oxygen associated with ingestion, digestion and assimilation of food. The energy intake may initially begin with 800 Kcal which can be slowly progressed to a 1200 Kcal diet till the patient is discharged. Thereafter, the patient's energy intake should be governed on the maintenance of body weight which is preferably 1 to 2 kg below IBW.


Related Discussions:- Energy during myocardial infarction

Explain coelomates, Explain Coelomates? Recall that Acoelomates have so...

Explain Coelomates? Recall that Acoelomates have solid bodies, and Pseudocoelomates have body cavities that form between the endoderm and the mesoderm. In contrast, the body ca

Difference between lamarckism and neo-lamarckism, DIFFERENC E BETWEEN LAMA...

DIFFERENC E BETWEEN LAMARCKISM AND NEO-LAMARCKISM - S.No Lamarckism Neo-Lamarckism 1. It refers of the original

Define issues that are covered by nutrition economics, Define issues that a...

Define issues that are covered by nutrition economics? The issues that are covered by nutrition economics include: 1. Quantities of food commodities and their development in

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain senning procedure, Explain Senning Procedure ? Operation is per...

Explain Senning Procedure ? Operation is performed by ascending arteries and separate SVC and IVC cannulation. If the operation is done under deep hypothermic circulatory arres

What is the modern darwinist theory, In the time of Darwin the results of M...

In the time of Darwin the results of Mendel's research on biological inheritance had not been published, Genetics was not yet developed, neither DNA nor the concept of genetic muta

Erysipelas, E r y s i p e l a s A sudden onset of infection wi...

E r y s i p e l a s A sudden onset of infection with the bacterium E rysipelothrix insidiosa ( E . rhusiopathiae ) is seen in turkeys and increasingly in free-rang

Classification, What is omnispective classification

What is omnispective classification

What is monohybridism, What is monohybridism? Monohybridism is the stud...

What is monohybridism? Monohybridism is the study of only one feature in the crossing of two pure individuals (hybridization) for that characteristic.

Which are the germ layers present in cnidarians, Which are the germ layers ...

Which are the germ layers present in cnidarians? Which tissues of the animal do they originate? These beings there ectoderm and endoderm, two germ layers. Animals with only two

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd