Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Ecosystem Degradation and Wildlife
Man is an animal with ecological requirements just like any other animal. It constantly needs a source of energy and.minera1 nutrients for its survival. It also needs optimum levels of, and a limited range of certain environmental factors, for its survival. Human beings are peculiar, in the sense that they have the capacity to modify the global ecosystems on a considerable scale. This is in order to redirect the products of the various ecosystems to fulfil the needs of: human society.
No other organism has produced such an impact on the physical, chemical and biological constitution of the earth. For this reason, it is necessary to look carefully at the relationship between man and nature from an ecological viewpoint. Such a study would help to locate those areas in which the stresses created by human beings are becoming intolerable and are threatening the future of certain species and habitats. This would also help in predicting the outcome of some of these harmful activities, and it may supply answers to a number of issues which are creating environmental dilemma.
What is phosphorylation? What are some biological processes in which phosphorylation plays a critical role? Phosphorylation is the name given to processes of the addition of ph
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is the nitrogen cycle? The nitrogen cycle represents the recycling and circulation of the chemical element nitrogen in nature. The nitrogen cycle fundamentally depends
The eukaryotic cell The eukaryotic cell is a complex unit and contains many structural features not seen in in the simple prokaryotic cell. Fig below shows the details of vario
Water Relations in Terrestrial Environment Insects are the largest group of metazoans which have most successfully invaded the terrestrial environment. In addition, most arach
Q What are muscle tissues? How is the function of this tissue related to the typical characteristics of its cells? Muscle tissues are that tissues which are made of cells able
describe the mechanism of allosteric change.
Which are the plant tissues that cover the stem and the leaves? The stem may be enclosed by epidermis (having stomata, cuticle and photosynthetic cells) as in monocots or, alte
Define the interaction of vitamin c with iron and cadmium? Toxic levels of dietary cadmium (5-200 ppm) interfere with iron absorption and produces iron deficiency. Supplements
Fire Protection - Factors Affecting Occupational Health Fire protection and extinguishing devices require to be installed at proper places in the work place and proper notices
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd