Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Occurrence of Biotin
Biotin occurs in nature very likely in all living cells, although usually in minute concentrations.
In animal organs and in yeast, biotin is mainly contained in bound form.
However, in vegetables, rice bran and in milk, it is present in free form.
Q. Why is carbon dioxide concentration a limiting factor of the photosynthesis process? And When the carbon dioxide concentration is increased indefinitely is photosynthesis also i
What are the factors to an actual shift in the supply curve? Factors which cause an actual shift in the supply curve are described in below: When prices rise or fall this wo
Parasite and host during incubation period Incubation period is the second stage in the process of a disease. It is the time between the day of infection to the appearanc
why protozoass dont have vaccines esp. plasmodiums
Define about the Chemotherapy - Cancer? Chemotherapy results in lot of side effects. This is because the drug effects are not specific to cancer cells alone. Even the host cell
Which is plant tissue responsible for the filling of the space between other tissues? Plant-filling tissue is basically called as parenchyma and the plant parenchyma can be div
Pathophysiology Infective endocarditis occurs when turbulence within the heart allows causative organism to infect previously damaged valves or other endothelial surfaces.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Development of Reserves - Conservation of Wildlife Establishment of Biological reserves, National parks, Forest reserves, Wildlife refuges and Biosphere reserves are effective
A decrease in parasympathetic discharge to the heart leads to A. a decrease in the conductance of F-channels in SA node cells. B. an increase in the conductance of potassium
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd