Determine the members of kingdom plantae, Biology

Assignment Help:

Which of the below is NOT a characteristic shared by most of the members of kingdom plantae?

a) They are nonmotile

b) They are multicellular

c) They possess bilateral symmetry

d) There is an alternation of haploid and diploid generations

ANSWER: C -- THEY POSSESS BILATERAL SYMMETRY

 

 


Related Discussions:- Determine the members of kingdom plantae

Explain the atmospheric dispersion modeling, Explain the Atmospheric Disper...

Explain the Atmospheric Dispersion Modeling 1. Dispersion model is a mathematical description of the meteorological transport and dispersion process that is quantified in terms

How do fishes do gas exchange, Q. How do fishes do gas exchange? Fishes...

Q. How do fishes do gas exchange? Fishes "breath" through gills, branchiae or Gills, are highly vascularized organs specialized in gas exchange under water and present in aquat

Explain the severe burns - clinical therapeutic nutrition, Explain the Seve...

Explain the Severe Burns - Clinical Therapeutic Nutrition? Severe, life-threatening bums require immediate care. Dehydration is treated with large amounts of fluids given intra

Photosynthesis., C4 plants have higher net photosynthetic rate because ...

C4 plants have higher net photosynthetic rate because a.they have no photorespiration b.can photosynthesise in low in

Quick transient responses - behaviour of plants, Quick transient responses ...

Quick transient responses - Behaviour of Plants Such responses are stimulated by factors showing significant variations over relatively small time period e.g., those showing w

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define cause of vitamin a deficiency - poverty and ignorance, Define cause ...

Define cause of vitamin a deficiency - Poverty and ignorance? Low purchasing power of the communities and their consequent inability to meet the nutrient requirements and tradi

Convulsive disorders, Convulsive Disorders Definition Convulsion ...

Convulsive Disorders Definition Convulsion is a series of forceful in voluntary contraction and relaxation of voluntary muscles due to disturbance of brain function. It i

The concentration of the tissue fluid, The concentration of the tissue flui...

The concentration of the tissue fluid, which bathes all cells in the body, is kept more or less constant. Why is this important? If the tissue fluid became more dilute, the ce

Define disadvantages of direct microscopic count, Define Disadvantages of D...

Define Disadvantages of Direct Microscopic Count? 1. Small cells are difficult to see under the microscope and may be missed. 2. It gives total count, i.e., both live and de

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd