Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Which of the below is NOT a characteristic shared by most of the members of kingdom plantae?
a) They are nonmotile
b) They are multicellular
c) They possess bilateral symmetry
d) There is an alternation of haploid and diploid generations
ANSWER: C -- THEY POSSESS BILATERAL SYMMETRY
Explain the Atmospheric Dispersion Modeling 1. Dispersion model is a mathematical description of the meteorological transport and dispersion process that is quantified in terms
Q. How do fishes do gas exchange? Fishes "breath" through gills, branchiae or Gills, are highly vascularized organs specialized in gas exchange under water and present in aquat
Explain the Severe Burns - Clinical Therapeutic Nutrition? Severe, life-threatening bums require immediate care. Dehydration is treated with large amounts of fluids given intra
C4 plants have higher net photosynthetic rate because a.they have no photorespiration b.can photosynthesise in low in
Quick transient responses - Behaviour of Plants Such responses are stimulated by factors showing significant variations over relatively small time period e.g., those showing w
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define cause of vitamin a deficiency - Poverty and ignorance? Low purchasing power of the communities and their consequent inability to meet the nutrient requirements and tradi
Convulsive Disorders Definition Convulsion is a series of forceful in voluntary contraction and relaxation of voluntary muscles due to disturbance of brain function. It i
The concentration of the tissue fluid, which bathes all cells in the body, is kept more or less constant. Why is this important? If the tissue fluid became more dilute, the ce
Define Disadvantages of Direct Microscopic Count? 1. Small cells are difficult to see under the microscope and may be missed. 2. It gives total count, i.e., both live and de
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd