Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Determine the Cardio-vascular System
Cardio-vascular system consists of a heart and blood vessels. The function of cardio- vascular system is to maintain blood supply to all tissues of our body. To some extent our cardio-vascular system can be compared with water supply in our cities and towns. For water supply we need a pumping machine which can be compared with our heart and lot of big and small pipes which can be compared with our vascular tree.
Before we proceed to know about cardio-vascular system, we should have some knowledge about blood and blood vessels.
What is the Importance of biotin Biotin is involved in a number of important metabolic reactions, probably as coenzymes. Deficiency symptoms are manifest as degenerative cha
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
In the case story, Reggie presented with three typical signs of hip fracture-shortening, adduction, and the lateral rotation of the affected limb. What causes these signs? (HINT-th
In chronic myelogenous leukemia, white blood cells proliferate ceaselessly. In affected white blood cells, the BCR-ABL oncogene, the result of a gene fusion, transmits a constitu
Why acquired traits are not directly related to the process of evolution? As acquired traits are not genetically determined, they cannot be passed on to offspring. Thus, they
Nervous System and Sense Organs The non-chordates also perform a variety of activities such as feeding, digestion, locomotion etc. For this aim, they have corresponding organs
Canine parvovirus infections The canine parvovirus infections are caused by a virus, which belongs to the genus Parvovirus in the family Parvoviridae. This virus is similar to
Q. What are the steroids? What are the few examples of steroids with a biological function? Steroids are lipids based in an angular combination of four carbon rings, one ring m
Q. What is the endosymbiotic hypothesis about the origin of mitochondria? And what are the molecular facts that support the hypothesis? And To which other cellular organelles can t
You are given a metaphase chromosome preparation (a slide) from an unknown organism that contains 12 chromosomes. Two that are clearly smaller than the rest appear identical in len
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd