Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
A new drug named ANTAG-CaSR has been developed that is an antagonist at calcium-binding sites of CaSRs (Calcium-Sensing Receptors) in the plasma membranes of parathyroid gland cells.
Healthy Person P receives regular doses of ANTAG-CaSR as part of a clinical trial. When ANTAG-CaSR levels in the extracellular spaces surrounding parathyroid gland cells increase in Healthy Person P, this leads to
A. an increase in the levels of calcium in the blood plasma.
B. a decrease in the levels of parathyroid hormone (PTH) in the blood plasma.
C. an increase in the amount of PTH binding to PTH Receptors in bone.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What happens when the oxygen supply is insufficient to maintain aerobic cellular respiration during muscle exercise? If oxygen from hemoglobin or myoglobin is not enough for th
What are the main biological functions of water? Water is the basic solvent for chemical reactions of living beings; it is the major means of substance transportation in the ce
Define Placental secretion of oestrogens During pregnancy? Placental secretion of oestrogens increase with progression of pregnancy. Oestrogens perform many functions. They sti
Since hypoglycaemia can occur in any diabetic patient at any time, it is important for you to learn the causes of hypoglycaemia. Such knowledge will help you to educate the patient
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Explain What is the optimum temperature for catalyses? Ans) For any chemical reaction, the reaction rate enhances with temperature, so the higher the temperature, the earlier t
Braxy The causative agent of braxy is Cl. septicum. It usually affects lambs. The agent is a normal inhabitant of soil and is frequently found in the faeces of herbivores. Bra
What is glycolysis? What are the products of this process? Glycolysis, the first stage of the aerobic cell respiration, is a process in which glucose is degraded (broken) to fo
What are the main representatives of the pteridophytes? Is this plant group cryptogamic or phanerogamic? The better known pteridophytes are the ferns and the maidenhairs, from
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd