Describe how enzymes assay is helpful in milk and meat, Biology

Assignment Help:

Describe how enzymes assay is helpful in milk and meat

Wheat seeds

a) Determination of α-amylase, content: an increase indicates sprouting/ germination of stored wheat;

Determination of reductase content: an increase indicates presence of bacteria

Milk

b) Determination of alkaline phosphatase and invertase: activity level of these enzymes indicate the effectiveness of pasteruization.

Meat

c) Determination of amines by the use of monoamine oxidase.

Related Discussions:- Describe how enzymes assay is helpful in milk and meat

Calculate the insulin bolus and drip rate , Mrs. M is a 35-year-old Hispani...

Mrs. M is a 35-year-old Hispanic female with no known past medical history; does not have a primary care provider (PCP). She presents to the emergency department with the following

How bone density affect osseointegration, How Bone density affect Osseointe...

How Bone density affect Osseointegration The most important bone property is density which is influenced by factors such as patient age and genetics. Higher density bones have

Genital warts and human papillomavirus infection, Genital warts and human p...

Genital warts and human papillomavirus (hpv) infection External genital warts are caused by human papillo- mavirus, usually type 6 or 11; other types (16, 18 and others) cause

Agro industrial-molybdenum, Molybdenum Although molybdenum functions as a ...

Molybdenum Although molybdenum functions as a component for the enzymes xanthine oxidase, sulfite oxidase and aldehyde oxidase, requirements for it are not established. Molybdenum

Explain the bioavailability of thiamin, Explain the Bioavailability of Thia...

Explain the Bioavailability of Thiamin? Thiamin is readily available from the gut from food sources (as thiamin phosphate esters). Drugs and alcohol abuse may interfere with th

Eggs of insect, EGG S OF INSECT This eggs is centrolecithal and it is ...

EGG S OF INSECT This eggs is centrolecithal and it is elliptical. It diameter is 2-3 mm. It has two eggs membrane i.e. vitelline membrane and chitinous capsule. The chit

Define the criteria for assessment of thiamin status, Define the Criteria f...

Define the Criteria for Assessment of Thiamin Status? Thiamin status has been assessed by measuring urinary thiamin excretion under basal conditions or after thiamin loading, t

Microorganisms acquired during transport of raw food, Microorganisms Acquir...

Microorganisms Acquired During Transport, Handling and Processing of Raw Foods Microorganisms can come from truck, tanker, food handlers and equipment and utensils used in the

List four common exercises you will recommend to a patient, List four commo...

List four common exercises you will recommend to a patient. Common exercises are: - brisk walking - cycling - swimming - playing tennis - dancing - rope skip

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages