Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define the Structure of Vitamins?
For your convenience, however, we have given the structures of these vitamins here in the text. Look at Figure which illustrates the fat-soluble vitamins. As you go through these structures, you would have noticed that all these fat-soluble vitamins have certain common features such as an aromatic ring structure with an aliphatic side chain, one or more double bonds either in the ling or in the side chain and a functional group such as an aldehyde (CHO: in vitamin A), ketones (C = 0: in vitamin K), methyl (CH3) or hydroxyl groups (OH: in vitamin D)
phylum protozoa
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Compare and contrast the effect of a deletion in the operator of the lactose operon with one in the operator of the tryptophan operon.
Explain Canning (temperature above 100° C) - method of food preservation? Canning is the process in which the foods are heated in hermetically sealed (airtight) jars or cans t
It is the most common (occurring in 75 per cent cases of ARF) manifestation of ARF. It involves large joints, it is typically fleeting in character shifting from one large joint t
What would happen to the energy flow through an ecosystem if the decomposers were eliminated? Without decomposers, the nutrients kept in the bodies and wastes of other organis
structure of oxysome
Q. Can Serotonin used in consciousness? Serotonin complements the action of noradrenalin and acetylcholine in promoting wakefulness and cortical responsiveness. Experiments pro
Explain Light in cell Metabolism? Energy for almost all organisms on earth is derived directly or indirectly from light energy produced by the sun. Sunlight consists of energy
Q. Why some trees lose their green color in the autumn? In autumn nights longer and days become shorter thus there is a reduction of the photosynthesis rate and some plants pre
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd