Define subphylum chelicerata, Biology

Assignment Help:

Define Subphylum Chelicerata - classes Arachinda AM merostomata?

The subphylum Chelicerata includes familiar horse shoe crab, spiders, scorpions, ticks and mites.

1. Body consists of an anterior prosoma and a posterior opisthosotna.

2. Prosoma bears the appendages involved in feedings and locomotion. Opistliosoma may have exterior segmentation but appendages are either absent or considerably reduced.

3. Their main appendages are clielicerae and pedipalpi.

4. Antennae and mandibles are absent.

5. These are the first land animals in evolution of arthropods which have successfully colonised the terrestrial environment.


Related Discussions:- Define subphylum chelicerata

Nutrition education for prevention of vitamin a deficiency, Define Nutritio...

Define Nutrition Education for prevention of vitamin a deficiency? Ignorance, you may recall studying earlier, is an important determinant of vitamin A deficiency. There is, th

Objective of the law of contract, The law of contract is that the branch of...

The law of contract is that the branch of law which determines the circumstances in which promises made by the parities to a contract shall be legally binding on them. Its rules de

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are fitness tests, What are Fitness Tests? Testing is an important...

What are Fitness Tests? Testing is an important evaluation tool for the sports performer as it gives them an insight into their current physical condition and the effectiveness

Differences between single-unit and multi-unit muscles, DIFFERENCE S BETWE...

DIFFERENCE S BETWEEN SINGLE-UNIT AND MULTI-UNIT SMOOTH MUSCLES     Single-unit Smooth Muscles   Multi-uni t Smooth Muscles

Gastrointestinal tract function , Gastrointestinal Tract Function: As...

Gastrointestinal Tract Function: As a result of burn  injury acute gastric dilation occurs, creating abdominal distention and  regurgitations. Malabsorption occurs secondary

What are the types of chronic gastritis, Q. What are the types of chronic g...

Q. What are the types of chronic gastritis? Gastroscopic observation shows different types of chronic gastritis: 1. Superficial gastritis: gastric mucosa is red, oedematous,

Diversity, who is the farther of bio diversity?

who is the farther of bio diversity?

Biodiversity and economics, With the survival and well-being of humans bein...

With the survival and well-being of humans beings so heavily dependent on biodiversity, its economic value assumes considerable importance. For instance the economic value of ecosy

What is mass transportation across the cell membrane, What is mass transpor...

What is mass transportation across the cell membrane? Mass transportation is the entrance or the exiting of substances in or from the cell engulfed by portions of membrane. The

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd