Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Subphylum Chelicerata - classes Arachinda AM merostomata?The subphylum Chelicerata includes familiar horse shoe crab, spiders, scorpions, ticks and mites.1. Body consists of an anterior prosoma and a posterior opisthosotna.
2. Prosoma bears the appendages involved in feedings and locomotion. Opistliosoma may have exterior segmentation but appendages are either absent or considerably reduced.
3. Their main appendages are clielicerae and pedipalpi.
4. Antennae and mandibles are absent.
5. These are the first land animals in evolution of arthropods which have successfully colonised the terrestrial environment.
Define Nutrition Education for prevention of vitamin a deficiency? Ignorance, you may recall studying earlier, is an important determinant of vitamin A deficiency. There is, th
The law of contract is that the branch of law which determines the circumstances in which promises made by the parities to a contract shall be legally binding on them. Its rules de
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are Fitness Tests? Testing is an important evaluation tool for the sports performer as it gives them an insight into their current physical condition and the effectiveness
DIFFERENCE S BETWEEN SINGLE-UNIT AND MULTI-UNIT SMOOTH MUSCLES Single-unit Smooth Muscles Multi-uni t Smooth Muscles
Gastrointestinal Tract Function: As a result of burn injury acute gastric dilation occurs, creating abdominal distention and regurgitations. Malabsorption occurs secondary
Q. What are the types of chronic gastritis? Gastroscopic observation shows different types of chronic gastritis: 1. Superficial gastritis: gastric mucosa is red, oedematous,
who is the farther of bio diversity?
With the survival and well-being of humans beings so heavily dependent on biodiversity, its economic value assumes considerable importance. For instance the economic value of ecosy
What is mass transportation across the cell membrane? Mass transportation is the entrance or the exiting of substances in or from the cell engulfed by portions of membrane. The
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd