Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Standard or Total Plate Counts (SPC/TPC)?
It is the most widely used method to know the microbiological quality of the food sample. It is quick and efficient method, giving the viable count present in the food sample. High TPC generally indicates poor quality of the food.
Q. What are the terms used in sterilization? Sterilization: It is defined as freeing the object or substance from all life of any kind. It is defined alternatively as the
What gum conditions may result from a failure to remove plaque? Gingivitis (gum inflammation) and periodontal disease (infection of the socket) might be result from a failure t
What is the secondary structure of a protein? The secondary protein structure is formed by the manner its amino acids interact by the intermolecular bond. These interactions ma
Based on your knowledge of neoplasia, discuss biochemical methods of detecting tumors, and imaging characteristics (in your particular imaging modality) that suggest malignancy. Ex
What are Taxonomic characters Taxonomic characters Classification is done on the basis of information we have. More information gives better classification. Modern taxonomy
list the major species of echinodermata
Q. Which is the kingdom of the parasites that cause malaria and Chagas' disease? Those maladies are caused by the protozoans, beings of the kingdom Protista. Q. What is the
Gregor mendel was an austrain augustianian monk; his work most notably showed that. a. Alleles segregate during meosis b. Capital alleles are dominant c. The genetic material is pa
principle behind seliwanoff''s test
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd