Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define observation or inference for picric acid test?
1. A mahogany red colour will be seen. The mahogany red colour indicates the presence of reducing sugar. All monosaccharides are reducing sugars and thus will give a positive picric acid test.
2. Maltose and lactose contain a free sugar group and thus can reduce picric acid in alkaline medium. Sucrose does not give this test as it does not have a free sugar group.
3. Starch with very few free sugar groups cannot reduce picric acid. Dextrin being a less complex molecule brings about partial reduction.
give an account of specific characters of phylum porifera
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Merits of Micro Propagation The special merits of micro propagation are: 1. It considerably increases the rate of multiplication 2. High rate of multiplication can be ma
Determine Pull-ups test for check the body strength? This test is also done to measure upper body strength or endurance by maximum number of pull-ups completed. Subject hangs f
Can you give me an example of the species that crossed a few habitats?
Explain the Precautions for Detection of Number of Bacteria in Milk? 1. Make a thin film of milk on the slide. 2. Do not over stain with methylene blue. If over staining ha
Photosynthesis happens in algae, green plants and photosynthetic bacteria. Its part is to catch solar energy and use this to drive the synthesis of carbohydrate from water and carb
Heteroduplex Dna is generated by the base pairing between complementary single strands derived from the different parental duplex molecules; heteroduplex DNA molecules occuring du
Q. What is S shaped incision? The S - shaped incision is indicated where a papilla needs to be developed and was first described by Palacci. This type of incision is essentiall
Q. Describe Coronary Spasm? Usually spasm develops at the site of subcritical or critical stenoses, but it may also occur in angiographically normal coronary arteries, the so c
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd