Define fermented dairy products-cheese, Biology

Assignment Help:

Cheese-There are several varieties of cheese manufactured all over  the world. All types of cheese are the byproducts of lactic fermentation of milk. There are several varieties of cheese which are classified as hard, semi-hard and soft cheese. These are prepared with culturing of the milk either with bacterial or mould species. Among the several varieties,  the popular ones are  cheddar  cheese and  Swiss  cheese which are known as  'hard cheese' whereas  Roquefort cheese  (blue cheese) is a semi-soft cheese and

the soft  variety  is the  camembert cheese.  The  cheddar cheese originated  from England and was adopted  in USA, the color of which ranges from white to orange- yellow,  depending upon the color added. The curing is done with the help of Streptococcus  and  Lactobacillus. The cheese is without  the  gas holes (the eyes), which characterizes the Swiss cheese. The Swiss cheese  is  cultured with the help of  a  mixed culture,  L.  bulgaricus,  Streptococcus  thermophilus  and Propionibacterium  shermanii which imparts the characteristic eye formation. The roquefort cheese  is prepared  by  the inoculation  of curd with Penicillium roqueforti and the  camembert  cheese  is produced  by  the fermentation  with  Penicillium camemberti.


Related Discussions:- Define fermented dairy products-cheese

Algal or planktonic fish poisonings, Algal or Planktonic Fish Poisonings: F...

Algal or Planktonic Fish Poisonings: Fish poisoning can result from the ingestion of fish or shellfish that have fed upon algae toxic to human beings. Paralytic shellfish poisoning

After the blastula stage what is the next stage, Q. After the blastula stag...

Q. After the blastula stage what is the following stage of the embryonic development? What is the passage from blastula to the next stage called? The blastula turns into gastru

Excretory organs, classification of excretory organs in helminthes, nermato...

classification of excretory organs in helminthes, nermatodes, annelids, molluscs, arthropods and echinodems

Percentage ratio of ash in honey, Q. Percentage ratio of ash in honey? ...

Q. Percentage ratio of ash in honey? Standards allow ash content in honey up to 0.5 per cent, but the ash of genuine honey seldom exceeds 0.35 per cent. It is determined by cha

What are the colors absorbed by plants, Q. What are the colors (of the elec...

Q. What are the colors (of the electromagnetic spectrum) absorbed by plants? What would happen to photosynthesis if the green light waves that reach a vegetable were blocked? C

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Measuring ecosystem diversity, Measuring ecosystem diversity is not easy, a...

Measuring ecosystem diversity is not easy, and ther e is no definite index for its measurement. It is generally assessed by the measure of species diversity in an ecosystem, often

Determine about the disease - brain tumor, Determine about the disease - br...

Determine about the disease - brain tumor Tumor, or neoplasm, is a mass of new tissue that persists and grows independently of its surrounding structures and has no physiologic

Chromosome jumping, Chromosome jumping is the technique whereby one begins...

Chromosome jumping is the technique whereby one begins with a piece of DNA from one area of a chromosome, and obtains clones from nearby areas without cloning everything in betwee

What are the respective functions of phospholipids, Q. What are the respect...

Q. What are the respective functions of phospholipids, carbohydrates and proteins of the cell membrane? Membrane phospholipids have a structural function they form the bilipid

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd