Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Cheese-There are several varieties of cheese manufactured all over the world. All types of cheese are the byproducts of lactic fermentation of milk. There are several varieties of cheese which are classified as hard, semi-hard and soft cheese. These are prepared with culturing of the milk either with bacterial or mould species. Among the several varieties, the popular ones are cheddar cheese and Swiss cheese which are known as 'hard cheese' whereas Roquefort cheese (blue cheese) is a semi-soft cheese and
the soft variety is the camembert cheese. The cheddar cheese originated from England and was adopted in USA, the color of which ranges from white to orange- yellow, depending upon the color added. The curing is done with the help of Streptococcus and Lactobacillus. The cheese is without the gas holes (the eyes), which characterizes the Swiss cheese. The Swiss cheese is cultured with the help of a mixed culture, L. bulgaricus, Streptococcus thermophilus and Propionibacterium shermanii which imparts the characteristic eye formation. The roquefort cheese is prepared by the inoculation of curd with Penicillium roqueforti and the camembert cheese is produced by the fermentation with Penicillium camemberti.
Algal or Planktonic Fish Poisonings: Fish poisoning can result from the ingestion of fish or shellfish that have fed upon algae toxic to human beings. Paralytic shellfish poisoning
Q. After the blastula stage what is the following stage of the embryonic development? What is the passage from blastula to the next stage called? The blastula turns into gastru
classification of excretory organs in helminthes, nermatodes, annelids, molluscs, arthropods and echinodems
Q. Percentage ratio of ash in honey? Standards allow ash content in honey up to 0.5 per cent, but the ash of genuine honey seldom exceeds 0.35 per cent. It is determined by cha
Q. What are the colors (of the electromagnetic spectrum) absorbed by plants? What would happen to photosynthesis if the green light waves that reach a vegetable were blocked? C
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Measuring ecosystem diversity is not easy, and ther e is no definite index for its measurement. It is generally assessed by the measure of species diversity in an ecosystem, often
Determine about the disease - brain tumor Tumor, or neoplasm, is a mass of new tissue that persists and grows independently of its surrounding structures and has no physiologic
Chromosome jumping is the technique whereby one begins with a piece of DNA from one area of a chromosome, and obtains clones from nearby areas without cloning everything in betwee
Q. What are the respective functions of phospholipids, carbohydrates and proteins of the cell membrane? Membrane phospholipids have a structural function they form the bilipid
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd