Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Fatty acid synthesis is the formation of fatty acids from malonyl-CoA and acetyl-CoA precursors by action of enzymes called as fatty acid synthases. It is a very significant part of the lipogenesis procedure that - together with glycolysis - stands behind formatting fats from blood sugar in living organisms. Such as β-oxidation, straight-chain fatty acid synthesis occurs by the six recurring reactions shown follows, until the 16-carbon palmitic acid is formed.
Q. Show Nutrition guidelines for prevention of heart disease? Nutrition guidelines for prevention of heart disease as suggested by WHO are highlighted. Details regardin
- Nuclear membrane disorganize at the beginning of this phase. - Spindle fibers originate and the kinetochore fibers attach to the kinetochore of homologous chromosomes from eac
Assume you are injecting a sub threshold depolarizing current step into a neuron. Draw the corresponding membrane voltage response; be sure to indicate the shape of the voltage cha
Give an example of how the public perception of science has been distorted or manipulated to serve an alternative purpose.
Why do leaves change color? Leave is the food factories of plants. During the spring and summer, leaves are actively making food and they are filled with chlorophyll, which giv
Q. Can you show the Systems of classification plants? The development of angiosperm classification has been one of the most fascinating subject. A study of sequential events le
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Which is the kind of gamete produced by a heterozygous individual? And what is the genotypical proportion of these gametes? The Heterozygous individuals, for instance, AA, prod
Ganglia - Organisation of Nervous System In between higher non-chordates with a central nervous system, you will observe that the association neurons and motor neurons are con
Q. Explain Use of Toxic amino acids? Lathyrus sativus (kesari dhal) seeds contain toxic amino acid beta-oxalyl aminoalanine (BOAA), is considered to be responsible
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd