Define components of total parenteral nutrition, Biology

Assignment Help:

Define Components of Total parenteral nutrition?

Glucose: Initiated at the rate of 6 mg/kg/min and increased upto 12-1.4 mg/kg/min, but care to be taken to prevent hyperglycemia.

Proteins: 3.5-2.0 g/kg/day and increased to 3.5-4.0 g/kg/day, cystiene is considered to be an essential nutrient for preterm infant.

Lipids: The recommendations vary from 0.5-1.0 day to 3.00 g/kg/day.

Electrolytes: Sodium 3.0-4.0 m mol/kg./day and potassium 2.0-3.0 m mol/kg/day.

Vitamins: The suggested parenteral intake of vitamin is:

Vitamins A: 280-5008 mg/kg/day

Vitamin E: 2.8 mg/kg/day

Vitamin K 100 8 mg/kg/day

Vitamin D: 4 8 mg/kg/day

Ascorbic Acid: 25 8 mg/kg/day

Thiamine: 350 8 mg/kg/day

Riboflavin: 150 8 mg/kg/day

Pyridoxine: 180 8 mg/kg/day

Pantothenate: 2.0 8 mg/kg/day

Folate: 56 8 mg/kg/day

Vitamin Bl2 0.3 8 mg/kg/day

From our discussion above, it is evident that feeding the 1BW infant is challenging.  Monitoring of the nutritional status of these infants is essential to observe the growth.The various parameters used are daily body weight record, weekly length and head circumference and periodic biochemical parameter assessment. We may end our -discussion by summing up that specialized nutrition needs for  preterm and/or low birth weight infants should be carefully monitored for prevention  of morbidity and promoting optimal growth and development. Next, we move on to lactose intolerance, which you may recall studying in Unit 14 earlier, is the inability to digest significant amounts of lactose, the major sugar found in milk. This is one of the common problems encountered during childhood. Let us learn the practical significance of lactose intolerance in children.


Related Discussions:- Define components of total parenteral nutrition

Determine about the multicellular organisms, Another possible way to classi...

Another possible way to classify organisms would be to separate them into unicellular and multicellular organisms. Explain why this is not a useful classification system. Other

Pseudopodia – protozoans, Pseudopodia – Protozoans Pseudopodia are flo...

Pseudopodia – Protozoans Pseudopodia are flowing cytoplasmic protrusions of the cell causing amoeboid movement. In protozoans pseudopodia exist in several forms. The most fami

Chordata, what are the two main subdivisions of the phylum chordata

what are the two main subdivisions of the phylum chordata

What are complementary genes, What are complementary genes? Does this inher...

What are complementary genes? Does this inheritance pattern obey Mendel's second law? Complementary genes are the different genes that act together to determine a given phenoty

Define classification of foods based on ph, Define Classification of foods ...

Define Classification of foods based on pH? Of these, the nature of the food, primarily the pH of food, is the most significant determinant of how severely the food will be pro

Explain use of rifaximin, Rifaximin (Xifaxan)  An anon-absorbed oral an...

Rifaximin (Xifaxan)  An anon-absorbed oral antibiotic, was about as effective as ciprofloxacin for treatment of travelers' diarrhea, mostly caused by E. coli. It is not effecti

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Enumerate about the halstead- reitan battery, Enumerate about the Halstead-...

Enumerate about the Halstead- Reitan battery As in the case of the Halstead- Reitan battery, one could present two theoretical bases for the Luria- Nebraska, one revolving arou

Difference between spermatid and spermatocyte ii, Q. What is the difference...

Q. What is the difference between spermatid and spermatocyte II? The spermatids (n) are the products of the second division of meiosis (meiosis II) in the male gametogenesis an

What are social dangers, Members belonging to the scientific community fear...

Members belonging to the scientific community fear the misuse of this therapy leading to dangerous consequences.  People may try to insert the desired gene, for example, the gene f

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd