Control of noise pollution, Biology

Assignment Help:

Following ways can be used for control of noise pollution:

  1. It can be controlled by designing, fabricating and using quiter machines.
  2. In heavy industries, sound proof insulating jackets or filters should be used by workers to reduce noise from machines.
  3. A silent zone around 100 meters of hospitals and schools can give comfort to ailing patients and allows smooth studies to students.
  4. Forest and dense growth of hedge bushes can effectively act as noise barrier.
  5. Trees should be planted along high ways, streets and other places which act as barrier between source and hearer.
  6. Efforts must be taken to create awareness among the general public about harmful effect of Noise pollution.

 

 


Related Discussions:- Control of noise pollution

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Which of the processes results in the atp, Which of the processes results i...

Which of the processes results in the most ATP production within a cell?

Local needs, Local Needs, Choices and Circumstances Beyond obvious cho...

Local Needs, Choices and Circumstances Beyond obvious choice for private sector, the best public-private balance for a country depends on its local culture and circumstances.

Locomotion in amoeba, Locomotion Continuous formation of new  pseudopod...

Locomotion Continuous formation of new  pseudopodia keeps amoeba in constant locomotion .This is called  amoeboid  movement .It  occurs  in many  other  protozoans , in  amoebo

Define the meaning of population structure, Define the meaning of Populatio...

Define the meaning of Population Structure? The structure of population can be viewed as to how the population is composed of in terms of age and sex. The structure of populati

Illustrate fundamental sexual life cycles, Q. What are the three fundamenta...

Q. What are the three fundamental sexual life cycles studied in Biology? Which of them corresponds to metagenesis? Which of them is the human life cycle? Sexual reproduction ma

Biochemical production , Biochemical Production: Plants are the foundat...

Biochemical Production: Plants are the foundation of a large variety of biochemical which are metabolites of both secondary and primary metabolism. But secondary metabolites ar

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd