Cell membrane lining the inner surface of the cell wall, Biology

Assignment Help:

Cell membrane lining the inner surface of the cell wall

The cell membrane lining the inner surface of the cell wall is made up of phospholipids (45%) and proteins (55%). Some E.coli cells have small thin filamentous extensions of the cell wall called the pili. While the cell wall serves to protect the organism from the external environment, it also allows small molecules and nutrients to selectively pass through. The cytoplasm of the cell is enclosed within the cell membrane. Within the cytoplasm lies a single molecule of double          stranded DNA in the form of an endless loop called circular DNA. The circular DNA molecule is tightly coiled to form the nuclear body (bacterial chromosome). In addition, most bacteria contain small circular fragments of DNA called the plasmids, which also carry genetic information independent of the bacterial chromosome.

 

1084_prokaryotes cell.png


Related Discussions:- Cell membrane lining the inner surface of the cell wall

Aves, What is aves?

What is aves?

Define counter stain - staining technique, Define Counter Stain - Staining ...

Define Counter Stain - Staining Technique? Finally, the smear is counter stained with a simple basic dye different in colour from crystal violet. Safranin is the most commonly

Creating a zoobook, Animal class....phylum arthropoda subphylum arthropoda

Animal class....phylum arthropoda subphylum arthropoda

Spirogyra, whats the meaning of asexual reproduction

whats the meaning of asexual reproduction

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Cerebral palsy, Cerebral Palsy Cerebral palsy is a non-progressive neu...

Cerebral Palsy Cerebral palsy is a non-progressive neuromuscular disorder characterised by disorder of strength, muscle control, posture or movement due to brain injury, befor

What is condition for the mendel''s second law to be valid, What is conditi...

What is condition for the Mendel's second law to be valid? The Mendel's second law is only valid for genes located in various chromosomes. For genes situated in the similar chr

Human reproduction, what stimulate pituitary to release the hormone respons...

what stimulate pituitary to release the hormone responsible for paturation name the hormone

Describe airway and respiratory support in heart disease, Describe Airway a...

Describe Airway and Respiratory Support in the Newborn ? Like in any other emergency situation a stable airway needs to be established first. Newborns with severe respiratory d

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd