Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Can you explain Restrictive Ventricular Septal Defect ?
VSD is restrictive when VSD pressure gradient is more than 60mmHg (systolic cuff pressure-VSD lpressure gradient = PA systolic pressure). PA systolic pressure can also be estimated Erom TR gradient. Tybulent jet is noticed in colour Doppler. VSOs are restrictive due to its smaller size or sometimes surrounding structur6s like tricuspid valve or aortic valve cover it partially. Whenever VSD is getting smaller due to aortic valve prolapse, aortic valve should be evaluated for incompetence and surgery should be advised at the right time so that valve cduld be preserved.
SPINAL NERVES 31 Pairs. Mixed type. Total weight 150 gms. At the base of origin of spinal nerves gland of swammardon or calcarious ganglion is present. Composed of m
what is omn viva ex ova?
Q. Explain Spray-dried milk powder? The milk which is concentrated by the process of spray drying contains about 40- 45% total solids. Do you know how the dried milk powder i
In the sarcomere of a skeletal muscle, there are A. myosin molecules in the I band. B. both tropomyosin and myosin molecules in the region of the A band that is not in the H
how many arrs are present in mataphasic telocentric chromosomes
What are CD4 lymphocytes? What is the relationship between these cells and HIV? How does HIV replicate? CD4 lymphocytes are T helper lymphocytes that there in their plasma memb
Q. Arthropod identity card. How are arthropods characterized according to examples of representing beings, basic morphology, type of symmetry, germ layers and coelom, digestive sys
Life style modification in the management of diabetes mellitus All of us have our own way of living. It becomes a routine when we do things in the same way. But when one falls
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
#question.bacteria and virus are meet so what happen.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd