Can you explain about thoracic aortography, Biology

Assignment Help:

Q. Can you explain about thoracic Aortography?

Aortic arch angiography has been used to assess aortic valve or aortic root disease. Thoracic aortography is helpful for assessment of aneurysms, dissection, vascular rings, coarctation, patent ductus arteriosus as well as assessment of stenoses of origin of great vessels. It is also helpful in assessment of aorta after blunt or penetrating injuries to chest wall.


Related Discussions:- Can you explain about thoracic aortography

Physical stress - temperature, Physical Stress - Temperature We are mo...

Physical Stress - Temperature We are most familiar with the plants and other organisms that live at temperatures close to the temperature range in which we are adapted to live

Explain about left cerebral hemisphere, How is it structurally explained th...

How is it structurally explained that the motor activity of the left side of the body is controlled by the right cerebral hemisphere and the motor activity of the right side of the

Male reproductive disorders-congenital disorders, Congenital disorders ...

Congenital disorders Poor fertilizing quality of semen could be due to impaired spermatogenesis. When such a condition is due to genetic congenital causes the treatment is not

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What do you mean by the coelom, Q. What is the coelom? To which structures ...

Q. What is the coelom? To which structures do coeloms give birth? Are all animals coelomate? Coeloms are cavities delimited by mesoderm and Coeloms originate the cavities where

Write the meaning of dsme, Q. Write the meaning of DSME? Generally, it ...

Q. Write the meaning of DSME? Generally, it is observed that soon after being diagnosed with diabetes, the patient gets worried or get depressed. This is a stage where the pati

Define whey protein concentrates, Explain Whey protein concentrates Whe...

Explain Whey protein concentrates Whey protein concentrates (WPC) are  the products derived from whey from which the water, minerals and lactose have been removed.  WPC is a wh

Issues to be discussed while counselling a diabetic patient, Q. Issues to b...

Q. Issues to be discussed while counselling a diabetic patient ? Issues to be discussed · Counselling at Diagnosis · Diabetes is Controllable · Counselling for Day

Explain senning procedure, Explain Senning Procedure ? Operation is per...

Explain Senning Procedure ? Operation is performed by ascending arteries and separate SVC and IVC cannulation. If the operation is done under deep hypothermic circulatory arres

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd