Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Can mitosis occur in haploid (n) cells? And in triploid cells?
The mitotic cell division can happen in haploid (n) cells, diploid (2n) cells, triploid (3n) cells, etc. Mitosis is a copying method that does not interfere with cell ploidy.
Formation of Gemmules Throughout the formation of gemmules, masses of food - laden amoebocytes called archaeocytes feed on other cells and lay down in within them. They get s
Which is plant tissues specialized in covering? The dermal tissues or covering tissues of the plants are the epidermis (that covers the leaves and the young stems and shoots) a
Plastids The term plastid first used by Haeckel (1865). These are present in plants and few protists (Euglena). On the basis of function plastids are of three types
Explain Insect resistant crops in Evolutionary way Insects are a natural selection pressure so plants resistant to certain insects could have an evolutionary advantage (in
What are the structural differences between roots and shoots? What structures are unique to each?
What is a membrane? Membrane is any delicate sheet that divides one region from another blocking or permitting (selectively or completely) the passage of substances. The skin,
Which of the following statements are true for fluid exchange between the blood plasma in a capillary in the leg and the interstitial spaces surrounding that capillary? A. Bloo
Q. Physical Signs of mitral regurgitation? Pulse is of normal character but carotid upstroke may be brisk. Atrial fibrillation is often present in a patient with advanced disea
EGG S OF EUTHERIA This egg is small & round. The dimeter of human egg is 0.1 mm. It has very little amount of yolk but they are also as alecithal egg. The egg is covered
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd