Biological species concept, Biology

Assignment Help:

The biologicaI species concept claims that species consist of natural populations and that species are real and objective. They are not man-made subjective abstraction.

According to this concept, the members of a species are a reproductive community. The species is also an ecological unit. It interacts as a unit with other species with which it shares the resources of the environment. The species is also a gene pool. These aspects of the biological species concept are made clear in the famous definition of the Harvard evolutionist Ernst Mayr. According to Mayr, "Species are groups of interbreeding natural populations that are reproductively isolated from other such groups". The biological species is not only a distinct unit at any given time, but it also has the evolutionary capacity to change continuously over long periods of time, measured in millions of years.


Related Discussions:- Biological species concept

How genetic predisposition causing the underweight, How Genetic Predisposit...

How Genetic Predisposition causing the underweight? Mother's Health Status; Poor nutritional status of the girl child coupled with under nutrition during pregnancy results in L

Animal nutrition, Briefly explain the following feeding mechanisms in holoz...

Briefly explain the following feeding mechanisms in holozoic organisms: filer feeding,fluid feeding and deposit feeding.

Proteins, what is he importance of proteins for living beings

what is he importance of proteins for living beings

What is fontan operation and modifications, What is Fontan Operation and Mo...

What is Fontan Operation and Modifications ? Earlier reported to have 20 per cent mortality, it has come down to five per cent in specialized centres. In the earlier series th

Determine the blood plasma levels of oxytocin, Which of the following serve...

Which of the following serves as an actuating signal, or as part of an actuating signal, in a system with feedback? (Either positive feedback or negative feedback) A. Blood pla

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Most important allosteric effector of glycolysis in liver, Name the most im...

Name the most important allosteric effector of glycolysis in the liver. Fructose-2,6-bisphosphate  is the most important allosteric effector of glycolysis  in the liver

Why is a leguminous crop rotation used in agriculture, Why is a leguminous ...

Why is a leguminous crop rotation used in agriculture? Leguminous crop rotation and other crop rotations are used in agriculture because in these plants many bacteria significa

Measurements of the level of pollution, Measurements of the level of pollut...

Measurements of the level of pollution There are many  factor for finding  the level of pollution in the waste waters that generally find out the quantity of organic matter susp

Genetics., Ask Two true-breeding pea plants were crossed. One parent is rou...

Ask Two true-breeding pea plants were crossed. One parent is round, terminal, violet, constricted, while the other expresses the respective contrasting phenotypes of wrinkled, axia

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd