Any topic, Biology

Assignment Help:
what is cell?

Related Discussions:- Any topic

Explain the cyclosporin, Q. What is the cyclosporin? How are fungi related ...

Q. What is the cyclosporin? How are fungi related to this substance? Cyclosporin is a drug discovered in the 1970's that revolutionized organ transplantation in Medicine, It is

What is tyrosinemia, Q. What is Tyrosinemia? There are two forms of her...

Q. What is Tyrosinemia? There are two forms of hereditary tyrosinemia. They are tyrosinemia Type I and tyrosinemia Type II. Type I was thought to be due to a deficiency of para

Vitamin d, defitionce of vitamin d

defitionce of vitamin d

To show that growing seeds take in oxygen, To show that growing seeds take ...

To show that growing seeds take in oxygen Cork up one end of a tube, having first placed inside some damp cotton wool and some mustard seeds. Immerse the open end in dilute ca

How structure of the subunits changed, The holoenzyme is denatured by heat ...

The holoenzyme is denatured by heat at very high temperature. It is found that two polypeptides, although denatured, contains chains that remain together as a unit, while two other

Illustrate about the neuropsychological assessment, Illustrate about the ne...

Illustrate about the neuropsychological assessment A neuropsychological assessment is a clinical examination of both the working brain and dysfunctional brain. Neuropsychologic

Insects - hormones in growth and reproduction, Insects - Hormones in Growth...

Insects - Hormones in Growth and Reproduction In insects hormones regulate moulting and metamorphosis. The larvae or nymphs which hatch out of the eggs undergo regular moultin

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain about simple proteins, Explain about Simple proteins Simple pro...

Explain about Simple proteins Simple proteins are those which are made of amino acid units only joined by peptide bond.  Upon hydrolysis they yield a mixture of amino acids and

Explain about the solar dryers, Explain about the Solar Dryers? There a...

Explain about the Solar Dryers? There are so many different designs for solar dryers, these range from simple convection dryers, cabinet dryers, shelf dryers to more complicate

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd