User Account

All Pages

Would the cells present have had to grow

Assignment Help Biology
Reference no: EM13935471

Hamburger ground under the best condition often has a bacterial count of 1000-10,000 per g due to contamination. If your sample had 10^6 bacteria per g, could this number have been just contamination or would the cells present have had to grow? Why? Give a good reason for your answer.

Reference no: EM13935471

Questions Cloud

Below is a partial production cost report : Classic 50s flooring produces linoleum flooring. Below is a partial production cost report for the Mixing Department.
External issues that are affecting the company : Evaluate the external issues that are affecting the company and have driven it to employ a strategy that has resulted in moving jobs offshore.
Paper - volkswagen huge diesel scandal : Write a research paper on given topic. Topic: Volkswagen's huge diesel scandal. You should be researchingyour topic as delivered to me earlier in the semester to write your paper focusing on the ethical,legal, and social responsibility issues that..
Write memo to managing director of worst performing company : Write a memo to the managing director of the worst performing company with recommendations of how the financial performance of the business can be improved.
Would the cells present have had to grow : Hamburger ground under the best condition often has a bacterial count of 1000-10,000 per g due to contamination. If your sample had 10^6 bacteria per g, could this number have been just contamination or would the cells present have had to grow? W..
What is maximum initial cost company would be willing to pay : Scanlin, Inc., is considering a project that will result in initial aftertax cash savings of $1.72 million at the end of the first year, and these savings will grow at a rate of 2 percent per year indefinitely. What is the maximum initial cost the co..
Consultants to bring gala information security : A project plan which incorporates the essential components of project management. This will include personnel, the activities to be undertaken by each team member, a timeline using an appropriate planning tool, the risks and threats to successful ..
Hr managers need to be up to the challenge : Written Analytical Essay (Individual) "Organisations are experiencing unprecedented levels of change in their environment, and HR managers need to be up to the challenge."
Write a script in perl : Write separate Perl scripts for each of the given requirements. Mentioned input data files are attached with this posting. In each case command to run the script from the command line should look like:

Reviews

Write a Review

Biology Questions & Answers

  Explain how stem cells obtained from fertilization

explain how stem cells obtained from fertilization in the fallopian tube and somatic cell nuclear transfer differ in terms of the source of their genome, age of blastocyst.

  What function does actin serve in a cell

What is the name given to the types of organisms that can use photosynthesis to produce glucose? Need three examples. What function does actin serve in a cell? Which organisms are considered the ancestors of land plants? If oxygen is lacking, how mig..

  Water is important to interactions of biological molecules

Water is important to the interactions of biological molecules because

  Which statements about competitive inhibition is true

Which of the following statements about competitive inhibition is true?

  Binding decreases the activity of the enzyme

What would your expected results be (growth or no growth) if you transformed bacteria with a plasmid that had ampicillin and kanamynic (another antibiotic) resistance and plated them. Situation growth or no growth and explain your reply.

  Climate data suggests a global warming trend

recent climate data suggests a global warming trend. the most likley cause could be an increase in which gas?

  Why are frameshift mutations insertions and deletions more

1. the following series of nucleotide bases forms part of a dna molecule tacttatgacacaggaggacta convert this string of

  Question about lac operon mutation

Think about a strain of E. coli that has a mutation in the gene encoding the IIA protein of the phosphotransferase system. The transport of glucose is not affected through this mutation.

  Percentage of the population that is homozygous

What is the percentage of the population that is homozygous for this allele and what is the percentage of the population that is heterozygous?

  How does the high concentration of urea in the cells

How does the high concentration of urea in the cells of the inner medulla surrounding the nephron make it possible for the fluid in the tubule to become concentrated (loose water)?

  Determine the possible blood types of the offspring

In most biology experiments the relationship between the independent and the dependent variable can be best described as cause and effect. Describe.

  Prediction of expected f2 progeny phenotypic outcome

What can be concluded about your prediction of expected F2 progeny phenotypic outcome from the F1 cross? Was it close to the observed outcome?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd