Reference no: EM13934963
1. Heparin is a polyanion that inhibits RNA transcription in vitro by binding directly to bacterial RNA polymerase (RNAP). If heparin interferes with the ability of the polymerase to bind DNA in a non-specific fashion, what subunit of RNAP is the heparin binding to?
2. The 5' end of the codon strand of a prokaryote gene is diagramed below.
+1
GACATAAACCCTTTGGGTTGACA(N)18GCTATAATGCCTCCAGTGGGA
I II III
GGAGGTGGAATGGAACCCGAG
IV
a. Which region(s) would most likely be protected from digestion by Dnase in the presence of the RNAP holoenzyme?
b. What would be the sequence of the 5' end of the encoded mRNA?
c. Upon transcription of this DNA, which region would contain the first codon to be translated?
3. A mutant of E.coli has constitutive expression of beta-galactosidase. A partial diploid formed with this mutant and F' I^+ O^+ Z^+ has normal, inducible synthesis of beta-galactosidase. What is the genotype of the mutant?
4. A mutant of E.coli cannot synthesis beta-galactosidase or beta-galactosidase permease in the presence or absence of lactose. A partial diploid formed with this mutant and F' I^+ O^c Z^+ Y^+ also cannot be induced to synthesize either enzyme. What possible genotypes could the mutant have?
|
Taxicorp is entirely financed with equity
: TaxiCorp is entirely financed with equity. Its risk premium is 14%. TaxiCorp calculates that a new project has a return of 16.5%. What other information is necessary to determine whether TaxiCorp should take the project? When should TaxiCorp accept t..
|
|
What level of EBIT will EPS be identical for Plans
: Destin Corp. is comparing two different capital structures. Plan I would result in 11,000 shares of stock and $80,000 in debt. Plan II would result in 8,375 shares of stock and $150,000 in debt. The interest rate on the debt is 6 percent. Ignoring ta..
|
|
Do not allow the user to resize the form.
: Remove minimize, maximize, and close buttons from the title bar
|
|
First steps in developing any kind of software
: One of the first steps in developing any kind of software is identifying who your users are. This then allows you to incorporate elements that are important to them, and grants you insights into how your target audience would use, or attempt to us..
|
|
What is the genotype of the mutant
: A mutant of E.coli has constitutive expression of beta-galactosidase. A partial diploid formed with this mutant and F' I^+ O^+ Z^+ has normal, inducible synthesis of beta-galactosidase. What is the genotype of the mutant?
|
|
Proposal for health information systems driving by ehealth
: Proposal for health information systems driving by ehealth
|
|
Fundamental quality management tools and techniques
: The assessment is designed for students to apply fundamental quality management tools and techniques. The assessment Hi-Sport Manufacturing Co. case and tasks are described in the course textbook on page 352 to 355.
|
|
Expected return and risk premium
: Irone Industries has a beta of 0.8. If the return on the market is 16% and the return on treasury bills is 5%, what is Irone Industries’ expected return and risk premium?
|
|
Describe the jobs of the workers who would be considered
: Define indirect labor. Describe the jobs of the workers who would be considered indirect labor in making this product.
|