What are examples of these structures that we find in humans

Assignment Help Other Subject

Reference no: EM133731756

Assignment: The Human and Chimpanzee Sequences Differences

The "leptin" gene makes a protein hormone that is important for regulating body weight and metabolism - studies have showed that mice without properly functioning leptin genes become morbidly obese.

Below is the DNA sequence of this leptin gene found in three different organisms (Mouse, Chimp, and human); only the first 60 nucleotides of this gene are shown.

Mouse: gaggga tcc ctgctccagc agctgcaagg taaggcccggggcgcgctact ttctcctcca
Chimp: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct
Human: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct

I. Can you find any DNA gene similarities between these organisms? Which ones are the most closely related?

II. How many differences are there between the human and chimpanzee sequences? How does the mouse sequence compare to the human sequence? (Hint: Count the DNA nucleotides)

III. Using this information how can DNA be used as evidence for evolution?

Watch the YouTube video "Proof of evolution that you can find on your body" and then answer the questions:

(For Closed Captioning, Click on the cc Button)

IV. What are vestigial structures?

V. What are some examples of these structures that we find in humans?

VI. Can these structure show up again in an organism? Give an example (Hint: Think mutations)

VII. How do these structure provide evidence for evolution? What the video and answer the following

VIII. Why did dark-colored rock pocket mice first appear in a population of light-colored rock pocket mice?

IX. Why do dark-colored rock pocket mice on dark lava flows have white bellies?

X. Mutations are always...

XI. When dark-colored fur gives mice a 1% competitive advantage and 1% of the population begins with dark fur, in about 1,000 years, 95% of the population will have dark fur. Which of the following statements is true?

XII. What does Dr. Carroll mean when he says "while mutation is random, natural selection is not"?

Reference no: EM133731756

Questions Cloud

How confident do you feel about developing : How confident do you feel about developing a research proposal as part of your future career as a nurse researcher? Explain your answer

What is the purpose of putting someone like your client : What is the purpose of putting someone like your client in prison for a nonviolent white-collar offense? Is he really a danger to society?

Create a project charter for the city of metropolis : Create a project charter for the City of Metropolis Geodatabase Design and Development Project and create a charter for the City of Metropolis geodatabase

How much should these bonds sell for today : If interest is paid semi-annually and the bond is priced to yield 8%, what is the bond's annual coupon rate - What is the closest value for its modified

What are examples of these structures that we find in humans : What are some examples of these structures that we find in humans? Can these structure show up again in an organism?

Analyze how the family of your chosen shows : Analyze how the family of your chosen shows are depicted. You should choose a movie or television show depicting a "family" from any time frame

Explain attorney and judicial misconduct : Explain attorney and judicial misconduct. Give examples of each and What is the definition of white collar crime including the Sutherland explanation

Female patient presenting to clinic for medication refills : Write a subjective on female patient presenting to clinic for medication refills for type 2 diabetes, hyperlipidemia, chronic pain, nerve pain and insomnia

What are the consequences of white collar crime : What is the definition of white collar crime including the Sutherland explanation with critcisms and What are the consequences of white collar crime

User Account

All Pages