User Account

All Pages

Vadose zone and into the saturated zone

Assignment Help Biology
Reference no: EM131431171

A spill from a gasoline tank releases benzene, toluene, ethylene, and xylene (BTEX) and methyl-tertiary butyl ether (MTBE) into the subsurface. The spill travels through the vadose zone and into the saturated zone. The Kow of the BTEX compounds is higher than the Kowof MTBE. What is the significance of the Kow in this scenario? How do we obtain the Kow information? Will the MTBE plume or the BTEX plume travel further into the saturated zone? Why?

Your response must be a minimum of 200 words.

Reference no: EM131431171

Questions Cloud

Write a paper for anti-trust enforcement about buffalo : Write a Economic paper for anti-trust enforcement about buffalo. The best possible answer will explain clearly the firm or individuals responsible for the behavior.
Problems maintaining body heat : An elderly woman and a middle aged woman who is quadriplegic may each have difficulties during cold weather. Explain why each person might have problems maintaining body heat.
Calculating the elasticity of demand : Using the midpoint formula for calculating the elasticity of demand, if the price of a good fell from $42 to $38
Historical cost or schedule data from like past projects : Do any of your organizations use the historical cost or schedule data from like past projects to estimate the cost or timeline for a new project? If so, do you believe it helps reduce variances?
Vadose zone and into the saturated zone : A spill from a gasoline tank releases benzene, toluene, ethylene, and xylene (BTEX) and methyl-tertiary butyl ether (MTBE) into the subsurface. The spill travels through the vadose zone and into the saturated zone.
What are the equilibrium price and quantity traded : Given the original demand for Z, if the supply of Z were increased by 15 units at every price, what would the new equilibrium price and quantity traded be?
Difference between porosity and permeability : What is the difference between porosity and permeability? How do these characteristics of the subsurface affect the fate and transport of chemicals?
What is the contemporary global issue or problem : What is the contemporary global issue or problem (social, cultural, or environmental) you intend to research? Your topic must be grounded in contemporary research and practice.
What do you believe is the logic behind warhols repetition : Please respond to the following discussion topics and submit them to thediscussion forum as a single post. Your initial post should be 75-150 words in length.Then, make at least two thoughtful responses to your fellow students' posts. If youhaven'..

Reviews

Write a Review

Biology Questions & Answers

  What is the explanation of ratio

If the purple-flowered plant is heterozygous for both traits, the expected ratio in the offspring is 1 purple-serrated: 1 purple-smooth:1 white-serrated:1 white-smooth. Instead, you see 4 purple-serrated:1 purple-smooth:1 white-serrated:4 white-sm..

  Briefly describe this biotechnology application

Biotechnology allows the use of living organisms or their processes for human needs or purposes. Currently, this topic includes such general examples as cloning, stem cells (adult, umbilical cord, and embryonic).

  Consider the meaning of the term ecology

Explain how each of these ideas works and find ways to link between them. Present examples from your experience to demonstrate an understanding of the principles involved.

  How do retroviruses reproduce

how do retroviruses reproduce

  Calculate the protein concentration of the original milk

Determine concentrations of diluted samples then use that information to calculate the protein concentration of the original milk Can someone please explain what i have to do PLEASE

  What is the function of a lenticel

What is the function of a lenticel, How are intercellular spaces important for this function and Include a picture of a stem and label the nodes, internodes, apical meristems, leaf buds, and flower buds

  Explain which biological concepts from the course

Explain how the article relates to this course. Identify which biological concepts from the course and / or text are relevant to the topic covered in the article.

  Bio lab experiment – question

Create an experiment in which you will test the effect of an acidic fluid on enzymatic activity. To complete this assignment, it may be useful for you to review the Scientific Method Tutorial.

  What is propability that mary and dick child have freckles

Mary has freckles,but her husband Dick does not.Mary's father has freckles but her mother does not.what is the propability that Mary and Dick's child will have freckles?

  Discuss the lifecycle of one helminth

Helminths are included in the study of parasitology but only one form of the worm is actually parasitic. Discuss the lifecycle of one helminth and state which form of a worm is parasitic larva or the egg.

  Why are frameshift mutations insertions and deletions more

1. the following series of nucleotide bases forms part of a dna molecule tacttatgacacaggaggacta convert this string of

  Cardiovascular disease infographic lab

Select a type of cardiovascular disease that you are interested in learning more about.- Do some research that addresses/answers the following criteria for your infographic.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd