Length of the newly synthesized strand

Assignment Help Other Subject
Reference no: EM132123051

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:dideoxy); the DNA is danatured, danaturant is removed and primer is annealed, and DNA polymerase is added.

a) What is/are the length(s) of the newly synthesized strand(s) in bases?

b) What is/are the length(s) of the newly synthesized strand(s) in bases if ddATP is excluded?

Please explain the process.

Reference no: EM132123051

Questions Cloud

What is tension headache : What is tension headache? What are the symptoms and treatment of tension headache?
Compare the theory of comparative advantage : In a critical essay, compare and contrast the theory of comparative advantage as presented by Carbaugh (2017) with Krugman's (2008) critique of comparative.
Why is it necessary to ask patients with migraine : Why is it necessary to ask patients with migraine if they have any tingling or numbness anywhere?
What is the ploidy of the dna : What is the ploidy of the DNA at the end of meiosis I? What about at the end of meiosis II?
Length of the newly synthesized strand : a) What is/are the length(s) of the newly synthesized strand(s) in bases?
Intestine relate to the functioning of organ : Animal cells How do the differently shaped cells of the small intestine relate to the functioning of this organ?
Why dose marx begin capital with commodity : Why dose Marx begin Capital with commodity? What is the distinction Marx makes between use value and exchange value?
What are the key terms of the article : Using academic scholarly research, find an article that addresses an ethical dilemma from the past five years and annotate it thoroughly.
Entration of water molecules : Where do you think the concentration of water molecules is higher: in the air surrounding the plant? Or in the plant tissue? Why?

Reviews

Write a Review

Other Subject Questions & Answers

  Cross-cultural opportunities and conflicts in canada

Short Paper on Cross-cultural Opportunities and Conflicts in Canada.

  Sociology theory questions

Sociology are very fundamental in nature. Role strain and role constraint speak about the duties and responsibilities of the roles of people in society or in a group. A short theory about Darwin and Moths is also answered.

  A book review on unfaithful angels

This review will help the reader understand the social work profession through different concepts giving the glimpse of why the social work profession might have drifted away from its original purpose of serving the poor.

  Disorder paper: schizophrenia

Schizophrenia does not really have just one single cause. It is a possibility that this disorder could be inherited but not all doctors are sure.

  Individual assignment: two models handout and rubric

Individual Assignment : Two Models Handout and Rubric,    This paper will allow you to understand and evaluate two vastly different organizational models and to effectively communicate their differences.

  Developing strategic intent for toyota

The following report includes the description about the organization, its strategies, industry analysis in which it operates and its position in the industry.

  Gasoline powered passenger vehicles

In this study, we examine how gasoline price volatility and income of the consumers impacts consumer's demand for gasoline.

  An aspect of poverty in canada

Economics thesis undergrad 4th year paper to write. it should be about 22 pages in length, literature review, economic analysis and then data or cost benefit analysis.

  Ngn customer satisfaction qos indicator for 3g services

The paper aims to highlight the global trends in countries and regions where 3G has already been introduced and propose an implementation plan to the telecom operators of developing countries.

  Prepare a power point presentation

Prepare the power point presentation for the case: Santa Fe Independent School District

  Information literacy is important in this environment

Information literacy is critically important in this contemporary environment

  Associative property of multiplication

Write a definition for associative property of multiplication.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd