User Account

All Pages

Is this a strand of dna or rna

Assignment Help Biology
Reference no: EM13936840

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?

ii) If DNA, what is the complementary strand?

iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?

iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?

v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)

vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Reference no: EM13936840

Questions Cloud

What is under armour doing to make brand personally relevant : 1. What is Under Armour doing to make its brand personally relevant, surprising, and easy to process?
Prepare summary journal entries for april : Prepare summary journal entries for April (without disposing of under- or overallocated conversion costs). Assume no direct materials variances.
What factors should sido consider before choosing a supplier : Which supplier should Sido choose? Show all calculations. What other factors should Sido consider before choosing a supplier?
Graded for technical content and from a grammar perspective : Write about Wal-Mart. It will be graded for technical content and from a grammar perspective. The paper should be approximately 2,000 words in length. References need to be cited throughout the paper and in the reference section
Is this a strand of dna or rna : If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code), What would happen to the reading frame if three bases were inserted/del..
Two network security software tools : They must be of a type listed on page 22. Other types are not acceptable unless explicitly agreed by the module leader. c. They must be agreed with your module leader. The means of reaching this agreement are described below.
Explain the importance of pointers : Assuming an array has to be sorted, inserting a new element required shifting, in the worst case, n elements, where n is the number of elements in the array, i.e.:
What are the criteria for good primers in a pcr reaction : What are the criteria for "good" primers in a PCR reaction? Describe how you would use site-directed mutagenesis to change a BamHI restriction site into an EcoRI site.
Factors that influence buying behavior : Factors that influence buying behavior - Cultural, social, personal and psychological. Include consumers buying decision process.

Reviews

Write a Review

Biology Questions & Answers

  A co transduction experiment is carried out

A co transduction experiment is carried out with three tightly linked genes, a+ b+ and c+, using a recipient strain of genotype a- b- c-. Among a+ b- transductants, 14% are also c+. Among a+ c+ transductants, 83% are also b+. And among b+ c+ transduc..

  Whenever a rabbit eats the lettuce in your garden all of

when a rabbit eats the lettuce in your garden all of the energy in the lettuce is used by the rabbit. is this statement

  Compute the acid dissociation constant

A 0.02 M weak acid solution was measured to have a pH of 4.6 determine the [H+] in the solution and compute the acid dissociation constant,

  How do antibiotics reduce bacterial biodiversity?

How do antibiotics reduce bacterial biodiversity?

  What is the resultant genotypic ratio

Dragon color and wing size are controlled by two separate gene loci with 2 alleles each. A dragon that is red with large wings (RrWw) mates with another that is silver with small wings (rrww).

  How would you interpret the meaningfulness of this finding

Examine the relationship between consumption of milk during dinner and night- time bedwetting and find a significant correlation of .25. How would you interpret the meaningfulness of this finding?

  Genetic based question

Suppose that the long ear lobes in humans is an autosomal dominant trait that exhibits 30 percent penetrance. A person who is heterozygous for long ear lobes mates with a person who is homozygous for normal ear lobes.

  What conditions will be adjusted to enhance preferentially

Design an enrichment culture medium and a protocol for the isolation and purification of a soil bacterium (e.g., Bacillus subtilis) from a sample of soil. Note possible contaminants and competitors. How will you adjust conditions of growth, and wh..

  Media components and environmental factors

Consider about what was discussed in the reading project in terms of media components and environmental factors, and develop hypotheses about.

  Why both copies of the tumour-suppressor gene must mutate

Animals always want to get the most from their resources by increasing the surface area throughout their organ systems. Please cite five examples and how it does this.

  Q transpiration is the driving force in water absorption of

q. transpiration is the driving force in water absorption of plants. plants depend on many physiological adaptations

  Label where the highest amounts of calories occur

Graph the rechargin of ADP + Pi to ATP. On the same graph, draw the KE for ATPbeing used for cellular work. Label the area that represents the cell using kinetic energy from ATP for work. Label where the highest amounts of calories occur.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd