Identify the new strand of dna that would be produced

Assignment Help Biology
Reference no: EM132750346

Using the DNA strand CCTTAAGGGATCACGTGGAATCAC, reading from the left, consider the impact of the second T(thymine) is mistakenly replicated as cytosine. This is a substitution mutation.

Identify the new strand of DNA that would be produced.

Reference no: EM132750346

Questions Cloud

Does the pay-for-performance plan seem like a good idea : Revising the Compensation Scheme One of the first things Rick Rencher wanted to do in his new position at SIL Manufacturing was to improve productivity through.
Prepare the journal entries on the books of stellar corp : Prepare the journal entries on the books of Stellar Corporation. On January 1, 2020, Stellar Corporation purchased a newly issued $1,300,000 bond.
Organizations are struggling to reduce : Organizations are struggling to reduce and right-size their information foot-print, using data governance techniques like data cleansing and de-duplication.
How dose renewable resources help with climate change : How dose renewable resources help with climate change compared to non renewable resources?
Identify the new strand of dna that would be produced : Using the DNA strand CCTTAAGGGATCACGTGGAATCAC, reading from the left, consider the impact of the second T(thymine) is mistakenly replicated as cytosine
How amount of overtime premium contained in direct wages : A manufacturing firm is very busy and overtime is being worked. The amount of overtime premium contained in direct wages would normally be classed as
Important step in the threat modeling process : Seriously addressing and correcting STRIDE threat is an important step in the threat modeling process.
How has event help in better understanding class material : How has does the current events of Covid-19 relate to employee recognition? Also how has this event help in better understanding class material?
Explain pros and cons regarding the use of rfid : Explain pros and cons regarding the use of RFID (Radio Frequency Identification) for inventory management. Does its use involve any privacy concerns?

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd