Identify the entire amino acid sequence of the protein

Assignment Help Biology

Reference no: EM133442077

Question: A DNA sequence containing a short bacterial gene is shown below. The DNA strand shown is the template strand for the RNA synthesis. (meaning the original DNA strands have already unzipped and this is the template to use) Answer the following questions about this sequence and be sure to answer all parts of the questions.

3' GACTCACTACGATAGCCCCCTCGGATGCACT 5'

A. Below this DNA template, provide the sequence of the mRNA that would be transcribed from the gene.

B. Use the mRNA generated above to show how the process of translation would occur from this mRNA. Utilize the genetic code in your textbook. Or from the powerpoint. For this part of your answer, be sure to first find the start codon in your mRNA and highlight the start codon in yellow. Also, be sure to identify the entire amino acid sequence of the protein coded by this gene and point out where the peptide bonds in your answer.

C. Specifically explain and show (completely) what the result would be if the T in boldface were mutated and were instead an G. Explain what type of mutation this would be and show what full specific effect it would have on the protein now produced. Be sure to show the full process with the mutated protein sequence.

Reference no: EM133442077

Questions Cloud

Explain ross list of prima facie duties : Explain Ross's list of prima facie duties. Is his list complete? Can you think of additional duties that should be added to the list?

Explain how you can use the evidence-based approach : Explain how you can use the evidence-based approach to design or propose a practical tactic to the public health problem, issue, situation, or concern

Explain how you believe science helped us or hurt us : Explain how you believe science helped us or hurt us during the COVID-19 pandemic. Does science always tell the truth? If science is bought and paid for

Describe the effectiveness and the rationale : Describe the effectiveness and the rationale for choosing this dating technique. Offer details and be sure to site references. Be sure to fulfill all weekly

Identify the entire amino acid sequence of the protein : Identify the entire amino acid sequence of the protein coded by this gene and point out where the peptide bonds in your answer

How does a modern philosopher moral philosophy relate : How does a modern philosopher's moral philosophy relate to their modern political philosophy? Use John Locke, Immanuel Kant, and Karl Marx to make a convincing

Describe three ideas concepts mechanisms that ai developers : Describe three ideas/concepts/mechanisms that AI developers have 'borrowed' from human cognition to develop AI agents. Define/describe the concept/idea

Write out your dilution scheme in a well labeled table : Write out your dilution scheme in a WELL LABELED TABLE. Include the dilution factor per step; and the final DF for each concentration (0.25 mm, 0.1 mM and 0.005

How does descartes, in meditation 6, prove the existence : How does Descartes, in Meditation 6, prove the existence of things other than himself and God? How does the fact that God is not a deceiver support this

User Account

All Pages