How many different types of trna molecules exist in the cell

Assignment Help Biology

Reference no: EM131872517

Assignment

1. During transcriptional initiation RNA polymerase holoenzyme recognizes the consensus sequences within the promoter of E. coli. What part of the RNA polymerase holoenzyme recognizes the consensus sequence?

2. Does RNA polymerase holoenzyme recognize the sense, or antisense strand? The antisense strand is used for what purpose during transcription?

3. A single strand of bacterial DNA contains the base sequence
-35 -10 +1
5' CGTGTATTGACACTGGTGAGCCACTATCGTATATTCCCTAAGTGAGTATTGG 3'

a. What is the complementary sequence? Draw or type this sequence just below and indicate its polarity (directionality) in order to create a double-stranded DNA sequence.

b. Under the double-stranded DNA sequence, draw or type the mRNA sequence that will be translated, and indicate its polarity.

c. Which strand of the DNA serves as the coding strand, and which serves as the template strand, for the synthesis of the RNA transcript for this hypothetical gene fragment.

4. If a stop codon is not included in the mRNA molecule, how would this affect the following:

a. translocation on the mRNA by polyribosomes
b. concentration of this specific polypeptide in the cell

5. How many different types of tRNA molecules exist in the cell? For what purpose (hint: why are there 20 different tRNA molecules)?

Attachment:- Bacterial-DNA.rar

Reference no: EM131872517

Questions Cloud

What are the assets employed in preparing your dinner : Problem: Cost of a Dinner. What are the assets employed in preparing your dinner? Did your full cost include depreciation on these assets

Women and members of minority groups into leaders : What are specific issues to consider when developing women and members of minority groups into leaders?

Explain significant challenges for african-american : Explain what you take to be the two most significant challenges for African-Americans and the U.S. medical community in overcoming disparities in treatment.

Explain the concept and purpose of the professional sports : Explain the concept and purpose of the professional sports team salary cap. Also explain the difference between a franchise

How many different types of trna molecules exist in the cell : How many different types of tRNA molecules exist in the cell? For what purpose (hint: why are there 20 different tRNA molecules)?

Analyze each reason listed above as a reason for a diversity : Analyze each reason listed above as a reason for a diversity of approaches to software construction and modeling, and give your opinion.

Evaluate how consultants can be good or bad for labor : Evaluate how consultants can be good or bad for labor relations. Analyze the types of tactics are described on their sites.

What was the addition to net working capital : If net fixed assets increased by $7,000 during the year, what was the addition to net working capital?

Determine variable cost per unit and total fixed cost : determine (a) the variable cost per unit and (b) the total fixed cost. Round all answers to the nearest whole dollar.

User Account

All Pages