User Account

All Pages

How many amino acids long will the small protein

Assignment Help Biology
Reference no: EM132186222

The following double stranded DNA sequence shows a "gene" encoding a small peptide. The three "stop" codons are UAA, UAG, and UGA.

5' ATGACGTATAATCACCGTAGATAACAGTAATTGATAAATCAG 3'

3' TACTGCATATTAGTGGCATCTATTGTCATTAACTATTTAGTC 5'

How many amino acids long will the small protein be that is encoded by this "gene"?

Reference no: EM132186222

Questions Cloud

Explain each quality in your own words : Prior to completing this assignment, read page 141 of Bensley and Brookins-Fisher (2009) and examine the nine qualities that make a good leader.
Why did you choose to become a teacher : Why did you choose to become a teacher? What excellence in teaching have you observed as a student or during observations?
In what way does scripture influence your decision to work : Discuss economic theory related to the quote above. Be sure to include a definition of Labor Force Participation Rate (LFPR) within your discussion.
Analyze a recent article from the wall street journal : You are required to read and analyze a recent article from The Wall Street Journal, each covering a different topic addressed in the course.
How many amino acids long will the small protein : How many amino acids long will the small protein be that is encoded by this "gene"?
What are the arguments being made about the site use : You must identify an important debate happening somewhere within the City of Los Angeles. The debate must involve the use of private and/or public space.
What strategies might you suggest to address the gap : What if...you were asked to be on an early childhood advisory committee for your community? What ideas could you offer to help promote children's success.
Events associated with the development of an ovum : Describe the regulation of spermatogenesis and the regulation of the endocrine events associated with the development of an ovum.
Examine the effectiveness of a multicultural curriculum : Develop a 5 page paper on your philosophical approach to Multicultural Education. Your paper must include the following items.

Reviews

Write a Review

Biology Questions & Answers

  What is it about life in the 21st century

We humans, have always examined our world about us, seeking more understanding. However, we examine our world differently today thanthey did thousands of years ago. In the beginning there was'natural philosophy' and this way of looking at our worl..

  How dose cytosine sis differ between plant and animal cells

How dose cytosine sis differ between plant and animal cells

  Determine the sequence of genes with chromosome

Determine the sequence of genes along a chromosome based on the following recombination frequencies: A-B = 8 cM; A-C = 28 cM; A-D = 25 cM; B-C = 20cM; B-D = 33 cM

  Q1 august weissmann did experiments that helped illustrate

q1. august weissmann did experiments that helped illustrate that the inheritance of acquired characteristics was not a

  Q a 22- year old man was in a motorcycle accident with

q. a 22- year old man was in a motorcycle accident with resultant neck injuries that led to partial paralysis of the

  What is phylogeny

What is phylogeny? Wondering for Bio 182. Missed lecture day that covered this topic.

  What advantage will heterozygotes have over the homozygotes

What advantage will heterozygotes have over the homozygotes. Why selection inevitably favors any gene that is good at getting into the next generation, regardless of whether that gene helps or hurts the ecosystem, the species, the group, or even the ..

  Alleles of glucose-6-phosphate dehydrogenase

There are the fast and slow alleles of glucose-6-phosphate dehydrogenase (G-6-PD), which is an X-linked gene. Why does a clone of heterozygous mouse cells

  The simple definition of a gene is a dna sequence

The simple definition of a gene is a DNA sequence

  Blindness and low vision

BLINDNESS AND LOW VISION • What are the instructional implications of the three general classifications of visual impairments that educators use? • How do blindness and low vision affect learning, motor development, and social interaction?

  Learning of bioethics in the future

How, when, where and why might you apply your learning of bioethics in the future if you wanted to be a veterinarian?

  Select two of these sexually transmitted diseases and

q1 choose two of these sexually transmitted diseases and explain the effects and the possible long term consequences of

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd