Explain how gene regulation in eukaryotes

Assignment Help Biology
Reference no: EM132510473

Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence:

AGTAAACGTACCTGAGACGGG

Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.Explain in detail and cite your work please. Add credible sources.

Reference no: EM132510473

Questions Cloud

How design would be checked from each role perspective : Explain how the design would be checked from each role's perspective, according to the information they require. Use these roles as an example.
Describe a developmental characteristic that echinodermata : 1. Describe a developmental characteristic that Echinodermata and humans share.
Organization of a sponge and that of other animals : 1. What is difference between the tissue organization of a sponge and that of other animals?
Focus on working capital management : Many newly minted college graduates work in positions that focus on working capital management,
Explain how gene regulation in eukaryotes : Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.Explain in detail and cite your work please. Add credible sources.
Create at least five security-related rules for staff member : Create at least five security-related rules for staff members who are adding web pages being added to your site. Include a justification and explanation.
Perform role in an organism : What are some of the structures inside a cell that help it to live and perform its role in an organism?
Prepare a financial analysis on the company : Prepare a financial analysis on the company using public information such as the company's annual report, SEC 10-Q and 10-K.
Compare and contrast the bryophytes : Compare and contrast the bryophytes, ferns, gymnosperms, and angiosperms.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd